GenePrediction:GLEAN_7219 Details

Name: GLEAN_7219
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3384245..3383418 (- strand)
Length: 828
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3384245..3384230 (- strand)
Length: 16
Type: CDS
Source: GLEAN
Position: GCSC_140:3384086..3384069 (- strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_140:3383956..3383924 (- strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_140:3383796..3383663 (- strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_140:3383606..3383527 (- strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_140:3383457..3383418 (- strand)
Length: 40
>GLEAN_7219 class=GenePrediction position=GCSC_140:3384245..3383418 (- strand)
ATGGTCAACATTCCGAGTGAGTAGGATCCCGTGGTCTCGGTCGATTGGGAGAGAACCTGGCCTTTGGCGGCCGTCCACGA
AAGCGCATTGCCACGAGCTCGAATCGTGTTTTCTTGTTTTATTGGACCCAGATTGCTGACCATGACTTCTGAATTTTAGA
GACGAGAAAGACCTACTGTACGTTCGCACCATGTTGCTCCTAGCACTCGCTCCGAGACGAATCGATCTGGATTGGCTGCT
TCGCTATTTTCCTCGACATGGGAATTGTGATTGTTAACTCGCAATACAGGCAAGGGCAAGGAGTGCCGGAAGCACACCCA
GCGTACGTATGACCTGAAGGGACGAGAGCAAACCCGGAGCGGAAAACCTGGGGTGGTCGAATGGTTCCTGCTTGGGTGCG
GACAATAGAGAGCAACGCAGTCGCTGACATCACGTCTTTCCTCCAACAGACAAGGTCACACAGTACAAGACGGGCAAGGC
CAGTCTGTTCGCTCAGGGAAAGCGTCGTTACGATCGTAAGCAGTCTGGTTATGGTGGTCAGACGAAGCAGATCTTCCACA
AGAAGGCCAAGACAACGAAGAAGGTATGTAGATCCGCAACGTGCCATGGAGACGTTTTGCTTACCTGGCCTTCTTCCAGA
TCGTGCTGCGTCTCGAGTGCACGTCATGCAAGGCAAAGAAGCAGCTGCCGCTGAAGCGGACCAAGCACTTCGAGCTTGGG
TATGTGGCTTTCTTACTCTCCTCAGCTTGCCGCGTCATGACATGAGACGATGGCTAACAACAGCGCAGTGGCGACAAGAA
GACCAAGGGCGCGGCGCTTGTGTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62