GenePrediction:GLEAN_721 Details

Name: GLEAN_721
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1638548..1639630 (+ strand)
Length: 1083
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1638548..1638609 (+ strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_97:1638662..1638756 (+ strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_97:1638871..1639487 (+ strand)
Length: 617
Type: CDS
Source: GLEAN
Position: GCSC_97:1639550..1639630 (+ strand)
Length: 81
>GLEAN_721 class=GenePrediction position=GCSC_97:1638548..1639630 (+ strand)
ATGGATCTTTCTAGGCTGACCGGCTTACCTTCGCTGCGACGGCAGAACCTGCTGGCCGAATTGTAAGTCTGCACCGCTGT
CCACCGCCTTTCATCAGCCCTGACGCGATGACAGTGTCGGATTTCGACAAGCCTGTCCGGCCGGAGTGTTTGTCAGTCTC
ACGCCGGGCGACCCGGCGCTCTGGACGGGCGTATTGTTTGTGCGAGATGGTAGGTGGCCGGAGCTTTTTTGTTACTTTCT
GTTCTTCTCTTCTTCCTTCTCTCTCTTCCCTCTCTCTCTTCTCTCTTTCTCTCTCTTTTCTCACCTCTCTTCCTCTCCTC
TAGGCCCCTATGCACCGGCCATCCTGCGCTTCCAGATCGTGTTTCCCGAGCGGTATCCAGCCCAGCCTCCGCTTATCACC
TTTGCCACCGACATCTTCCACCCGCTCGTGACGCCGCTGACGATGAGCGCGGCCGACGACGAGAACCTGCCACCGGGTGG
CTTCAGTCTGCGCCACGGCTTTCCGGTTTGGTTCAGCAGCCAGGGTGCTGCCCGCCGGCAGTCGGCGTCGCTGGTGCAGA
CGCCTCCTCGAGCTGATGCTGCCGATGCTGCCGATGCTGCTACGGCTTCGACTTCGGCTTCGATCGCCAGCACCCCCTCC
TACATGCAGACGCAGCCGCGGGCCGACGACGTGGCCACGTACGACGTGCTGCGCTACATCCGCAGCACCTTTGACGACGC
GACTGTCCTCGACGCCATCCCGCTCGAATCTGCCGGCAACCCGGGCGCGTGGCACGCGTGGCGCGCACATCGCCGACAGT
CCGCCCCGACGACGGCTCCGGCCCGGGAGCCGGGCGAGTGGAACTGGGAACACGTCTGGGAAGAGCGGGTCAAGAACGGC
ATCAACGTGAGCGTGTCGGACGCGGTACTCTACGGCGGCACAGTCGCGACCGACGACGTGGTGAGTACATAAAAGACCGA
CCCAGAGACCTAGACCAAGACCTGACCTGTACCCATAACCAGATCCACTTTCTCTCCATGGACGACGGCGACGTCGAGGC
GATCAAGGCCAACCTGAAGCGGACCCTCGACGTGACTGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62