GenePrediction:GLEAN_7221 Details

Name: GLEAN_7221
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3367086..3362354 (- strand)
Length: 4733
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3367086..3366333 (- strand)
Length: 754
Type: CDS
Source: GLEAN
Position: GCSC_140:3366264..3365523 (- strand)
Length: 742
Type: CDS
Source: GLEAN
Position: GCSC_140:3365453..3362663 (- strand)
Length: 2791
Type: CDS
Source: GLEAN
Position: GCSC_140:3362596..3362354 (- strand)
Length: 243
>GLEAN_7221 class=GenePrediction position=GCSC_140:3367086..3362354 (- strand)
ATGGCCGGCGGCAAAAAAAAGAAGAAGCCCGCGGCCAATGCAGCCAGAGGCTTCGCTACGACTTCCATTGCTTCCAAGCC
ACGAGTCGAGCTCACCGAGGACCCCGACGCCACCGCCGGAAAAGGAAAAGACGGCACATTACCGGCCAAGGGAGCGGCAC
CACAAGAGGCGGCAGCGACAGCAACAGGCAACATTGCCGCGGACAGCTCCGGTAGCACTGCACAGAAGACTCTGAGTCCG
GAGGAGTTTGAGAGACAGCTCGAAGAATCAGAGTTGCAGATCCTCGTGGACAAGCACGCACAGAAGATCCGGCGAGATGC
CCAGCGACAGATGAACCGGCTCGAGACCGATCGCCGGCTGCTGAGAGGACAGGCTGAGTCGATCAACTCTAAGAAGTGGA
TTCCACCAGATCTCATGGACCAGATCTTGGATCTGATCCAGTCGGAAAGTCGATTCGCTGGATCCAATGTCCCGTCCGAA
AGTGCTCCAGGGGGGCGACTCCTGCCTGAGGAGGATCTGACGATGAAGTTGTGGACACTACAACAGACACTAATCTCTGC
AGGGTTTTCCGAAACCAAGGTCGAGAGCGTGCTGAATTACGTTTTGCATATCTCCACTCAGATTGGAGCACCAGGAAAGG
ACTCCATATGGGGTATGGAGGAGGCGTTGGAATGGCTCGCCCGAGAAAGCTCCCTCGACGAGCTACCAGACTACAACAAG
CGGCATGGCTCGGGAGGAAAGGGGCAAGCAGCAGGTACGGCTCTTGCATCGCACATCCATCTCACCAGCCCTGGCATTGG
TTAACTTTCGATGACGCTGTAGACACGCCGTTAGATGCCCCACTTTCTTCTGGGACAACGACGCCGCTGCTGCTGGCGCC
TGAGAGCCAGCAGAAGAGAGGCAAGGGCGGCAATGCACAGAGGGTGTCGAACGCTGCCTCTGCACGGCTAGCGATAATCA
AGTACGATGGTGACATTGAGCCGGAGGAGCTGGTGCCAATGTACTTTGCCGCGAAGGAGCGGCTGTTTGCTCTTGAGCGA
CCGCGACAAGAATCGGCCAAGGGCAAAGCCACCAAGGTATCGCCGACACCAGTAGAAACCGAGGCAGAGAATGTTGAGAT
CTCGAAACTTTTGGGAAAGCTGGATCGGATACAGAAAGACATCCTGTTCGACAAGAGGCTAGCTGAATTGCAGTGGCGGT
CCAAGAAAATCATCTTAGAGCGAGAGTACGCAGAAGCAGCCAAGAGAGCTGCAGAAGAGGTGCGCAACCAGGCCGAGGAA
GCAGCAGCAGTAGCAGATACGGGCAGGGCAGAGTCCGAGGCAGACGGCGATGTCAACGCAGAAGCCGAACGAGTGGCAGC
AGAAATTCTGGCACAGGACGACAGCGATGACGACGGCCTTACCGATCTCTTTGCCAGCCTGCCGGTAAACGAAGTTGATC
CGGAAACGGGCAAGACAAACATGGTGGTGAACAATCCGGACGGATCGAAGCTCATCATCCGGGACTTTGGGAAATGGACT
GGCATGAGTCCGGTGCGAGTGCTTGAAGAAGCATGCAGATCACGGTGAGTACAGGGATGGCGGCCGATGGCACGGGCGAT
TGTACGATGCGGTGAGCTGACAGCAGGATGCAGCGATTCGTCAGTTCGGATTGGCTACCAGACGGTATCAGAGGCGTCGT
TTGCGCACCGACACTTAGTGGTAATAAATTGGGCGAAGGCCCAAGACATGCCACAACTGCCTCCGACTCCGCACATTGAG
GTTGCAATGCAGCCCAGCCGGTTCGTTTTCAAGATGTCTGGTGTCGCCTGTCCGGAAAGCAAGCAGTCGGAGGCCTTCAT
AGCGACGTCGGCACTCTTTCTGATTTTCAGCACGTCGACAAAGGAGGAAAAGGTGGCGCTGCGGCTTCCGGCCGTGTGGC
GAGATCTGTGGGCCGAGTTTGCGGAATCGAGAAAGAACCAGGCGGATGCGCACGACCGGGCAGCAGTCAAGGAGCTCCGC
GATCTCGTGCGGAAACGACGGGATCAGGAGCTGGAGGACGGCGTGGTGCTCCAAGGAGCGTTCCGTGGACGAGCAGCAGG
ACGGAACGGCGGAGACAACGGCGAAGACTCTGGGGCAGAGCGAGGCAGTCGCGGTGGCCACGATGCGGAGTACTACCAGC
GGATCTGGCAGGAGAAGAGCAGTACGTCACGGTACCAGGCGATGCTGCAGTCACGGATGCAGTTGCCGATGTGGGCATTT
CGGCAGCAAGTACTCGACACAGTGGACCGCGAACAGGTGGTGATTGTATGCGGTGAGACGGGATGCGGCAAGAGCACGCA
AGTGCCGTCGTTCCTGCTGGAGCACCAGCTGTCGCAGGGGAAGCCGTGCAAGGTGTACTGCACGGAGCCGCGGCGAATTT
CGGCGATCTCTCTGGCGCGGCGGGTGAGCGAAGAGCTAGGTGAGGGCCGAAACGATGTGGGAACACTGCGGTCGCTGGTG
GGCTTCTCGATCCGACTGGAGGCCAACACGTCCAAGGAGACACGACTGGTCTATGCGACGACGGGCATTGTGATGCGGAT
GCTGGAGGGGTCGAACGAGCTGCGGGAGATCACGCACCTGGTGCTGGACGAGGTGCACGAGCGGTCGATCGACAGCGACT
TTCTGCTGATCGTACTGAAGAAGTTGCTGGTGCGGCGACAGGACCTCAAGGTGGTGCTGATGTCGGCGACGGTGGACGCG
GACCGGTTCTCCCAGTACCTCGGAGGGGCACCGGTGCTCAATGTGCCAGGACGGACATTCCCGGTGCAGGTGCGGTATCT
CGAGGATGCGGTGGAGCTGACGGGATACTCGGTCGATGGGCGCAGCCAAGAGCGTGTGGTGGATCTGGACGATGATTTGG
TGGCAGACGAGACGGAGACGTCGTCGAAGCCGGAGCTGCTGAAGACGCTCAAGGGCTACTCGAACCGGACACGCAACACG
CTGTCGCAGATGGACGAGTATCAGATCCCCTTTGAGCTGGTGGTGCAGCTGATCGGGCGAGTGGCAACAGATCCGGAATA
CGAGCGGTACAGCCGGGCGATCCTGGTGTTCCTACCGGGAATTGCGGAGATCCGGGCGCTGAACGATCTGCTGGTAGGCG
ACCGGGCATTTGCGGCCGGCTGGCTGATCTACCCGCTGCACTCGACAATTGCGACGGAAGAACAGGAGGCGGCCTTTCTG
GTGCCGCCGGCGGGCTTCCGCAAGATTGTGCTGGCGACCAACATTGCCGAGACGGGCATCACGATTCCGGATGTCACGTG
CGTTGTGGATACGGGAAAGCACCGAGAGATGCGATACGACGAGCGGCGGCAACTGTCGCGGCTGATCGACACGTTCATCT
CGCGCGCAAACGCAAAGCAGCGCCGCGGTCGAGCTGGCCGTGTGCAGGAGGGTCTATGCTTCCACCTGTTCACGCGGTAT
CGCCACGACCAGGTGTTGAGCGACCAGCAAACGCCGGAGATGTTGCGGCTGTCGCTGCAGGATCTAGCCATCCGCGTCAA
GATGTGTCGGATCGGGGCGATCGAAGAGACGCTGGGCCAGGCTCTGGACCCGCCTTCGGCCAAGAACATGCGGCGGGCCA
TCGACGCGCTGGTGGATGTGCGGGCGCTGACAGCTGGCGAAGAGCTGACGCCGCTGGGAATGCAGCTCGCACGACTGCCA
CTGGACGTCTTCCTCGGCAAGCTGGTGCTGATGGGGACTGTTTTTCGCTGTCTGGACATGGCCATCACCGTGGCTGCAGT
GCTGTCGTCCAAGTCGCCGTTTGTGGCGCCGTTTGGCCAGCGCGCCCAGGCCGATGCCGTGCGTCTAGGCTTCCGTCGCG
GCGATTCGGATCTGCTGACGATCTACAACGCATATCTGGCCTGGAAGCGAGTCTGTCAGTCGGCTGCCGGTGCGGCCAGT
GGCCAGGAGTTTCAGTTTTGCCGTAAGAACTTTCTCAGCCCTCAAACCCTGGCCAACATTGAGGATCTCAAGGGCCAGCT
GCTGGTGTCGCTAGTCGACTCTGGCTTCCTGCCGCTGACCGACGACGAGCGTCGAAATCTCGGCCGTCTGCGCTATGCCG
GCTCCTCCGGTCGGGGTGGCCGCCGACGACAGGCCTTTTTCGACGTGCCGCAGCGTGTCAACAGCAACAGCGACGTCGAC
GTCGTGGCCCAGGCCGTCATCGCCTGGAGCTTCTACCCAAAGCTGCTGGTGCGCGATGCCGGTGGTGGCGGCACCGGCCT
GCGCAACATTGGCAACAACCAGACCATCCGGCTGCACCCCTCGAGCGTCAACAGGGGCCGCAACGACCTGCACTGGCTGT
CGTACTACCACATCATGCAGGCCAAGTCTGTGTACAATGCCCACGAGACCACCGCTGTCGAGGCCCTGCCGATTGCCCTC
CTGTGCGGTGACCTGCGATGTGATGTGAGTGTTGTTCTGTTGTTCTGTTGTTCTGTTATCTTGTGCTCTTGTTCGCTTCT
GACTATCCAGATGTTCTCGGGCGTCCTCATCCTAGACGGCAACCGCGCTCGCTTTGCCGCACCCGACTGGAAGACCCTGC
TGGTCATCAAGGTCCTGCGTGCTCGTCTGCGCGAGATGCTGTCGCGCGCTTTCAAGATGCCCGGAAAGCTGCCCACCGCC
CAGCACGAGAAGTGGTTCGCCGTCTGGCAGCGCATGTTCTCCCAGGACTTTGGCTCCGAGTCCACCAACGGTGCCGGCCC
ATCAAAGACCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62