GenePrediction:GLEAN_7222 Details

Name: GLEAN_7222
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3351327..3346689 (- strand)
Length: 4639
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3351327..3351190 (- strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_140:3351115..3350989 (- strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_140:3350918..3350160 (- strand)
Length: 759
Type: CDS
Source: GLEAN
Position: GCSC_140:3348194..3347167 (- strand)
Length: 1028
Type: CDS
Source: GLEAN
Position: GCSC_140:3346880..3346689 (- strand)
Length: 192
>GLEAN_7222 class=GenePrediction position=GCSC_140:3351327..3346689 (- strand)
ATGTCGGCCGAGAAGAGACGAGCATCCAACACGGATCCCAGCAAGCAGCTGGTGAAGCGACCGAATCTTGGAGGAAGTGG
CGGCAGCGGAGGATCGAGCAAGGCGGGAGGCTCAGGCAGCAATGCGCTGATTCAGGTGGTATGCTAGTCTACTCTATGCG
TGCCGACGCAGCAAAGCGACATGTGGCGGCCAATGCTGACGGCAGGGCGCAGGAACCACGAACGAGCGGCCTCCAGGCGC
CGGTGATGCAGCTGAGCGGCCATGCAGACGAGGTGTTCTGCGCCAAGTTTGATCCGGCGGGTCATCTGATTGCGTCTGGG
TCGATGGACCGGTCGATCTGTGCGTTGTGTGATCCCCTACGTGCCATTGTGCATCGTTGTTCGGAAGCTGCATCTGCTGA
CTCATCCAGTGCTCTGGCGGACGTACGGCGACTGCGAGAACTACGGGGCGCTGACGGGCCACCGCGGCGCAGTTCTGGAC
CTGCAGTGGTCACGCGACTCGGACGTGTTGTTCTCGGCATCGGCCGACACGCAGCTGGCCAGCTGGGACCTGACGTCGGG
GCAGCGGATCCGACGGTACGTGGGCCACGAGGAGATTGTCAACACGCTGGACATCAGCCGGCGCGGCGAAGAGCTGCTCT
ACAGCGGCTCCGATGACGGCTCGCTCGGCATCTGGGACCCGCGCAGCAAGAACGCGGCCGACTACATCCAGACAGACTTT
CCGGTCACGGCGGTGGCGGTGGCCGAGGCCGGCCACGAGCTCTACAGCGGCGGCATCGACAACGACATCCACGTGTGGGA
CGTGCGCAAGAAGGCGGTCGTCTACACGCTGCACGGCCACCAGGACACGGTTACGGGCCTGCGCGTGTCGCCCGACAGCC
AGTCGCTGCTCTCGTTCGCCATGGATGCGACGGCGCGCACCTGGGACATCCGGCCATTTGCCCCGACCGAGCGCCACATC
CGCACGTTTGACGGCGCCCAGACCGGCCTGGACAAGAACCTGGTGCACGCCAGTTGGGACCCCAGCAGTCGCCGCATTGC
CGCTGGCTCCGGCGATGGCACCGTCGTCGTTTGGTCCAGCGACAACGGCAAGCTGCTCTACAAGCTGCCCGGGCACAAGG
GCTCCGTCAACTCGGCCGAGTTTTCGCCGGCTGAGGACCAACCGATCAGTGCGTCCTCCCTCGCTCCCAGCCTTGCTTCT
CCCTGCTAACGTCCTTCCAGTCCTCTCCGCATCCTCTGACAGGACGCTGCTACTTGGCGAGCTCAAATAAAGAGGCCATT
CTCCAGTGCACGAACAGAAATGACGTGCACAGATTCGCAGAGCCCCCCTTGTCCCTCCCTCACGCGCCGGGAGATGCGCG
TTGTGCCCCTCTGCAAGACTAGACGAGGGAGGGTCATAGGCCATGCGTGTCCGCCGACGTGCTGAACAAGGCTCGTGATC
GCCCGGCTGGCTGCTCGTTCACGTGTCCTGCTTGCACTCAATGGCGGGCATCCGGGCTCCGACAATGGCCGACGAACAGG
ACGGACTGCTCCGCGAGGTGCCATCTGGGTGGACCCCTTTTTTATGCGCTGGGATGCCGGGGGCAACTGCGAGGCGCCCG
GCTGAGACGAGCCTTTTCTGATTGTGGCGGATGGCGAGTCTGTCTACAAATCTTCCATAGCAGCAGCTTACAAGTAATGG
CTCCAGCGCATGACGGCGGATGGCGCAATTCCAATGGATATGAATAAGGATAAGGATAGATGAGCGGTGCTGTAGCAGCA
AGAATGGGCATGTTTGCAATTGACGTGCACATGCACTTTTGCTTGGCTGGTTTTGTTTTTTACGGATCTTTGCTGCCTCG
ACTGTAGGAAAGAGACCTTCTCGCCGCAGCAGGCGGATAACGGAGATGGTCCGAGCTCGCAGCACCGAGCTGTGGCTTAT
TCGCCAGCCAGATTGGACGGAACTCGTGTCGCTGCGCCAGGTACTCCGTATATTACTGAAACAAGGACCCCTGGCAACCC
CTGCATCTCTACCAAGACTGCACAAAACTACACGACCCGGCCGTCTCGTTGCTATCATCAGGGCCCCTTTTGCCTATTAT
GCGACACTTCGGCCGCGTTACAGAAGGGCCCTATCGTCCCCCCTCTTGCCCCGTATTAAGAGATAGCCTCTTCGCTAGCA
CCAAAAAGAACATGGCTGCCACAGATGCCGGCGCAAAAGAGGGCGCCAAAGGTCCCTGTCGCCTCCGAATGCAAGACATG
CTGTATTTCGAGATACGAGCAATAAGCATGTACAGACACGATGTACGCAGCCCTGCGCGACCGCTTTCTACGCAGCCTAC
GCGGTATGCAACCCCAAGCCTGTTCCATGCAAGCTCTGGTTTGAAGAAGGGCAAGGATAGGATGCATATAATTCGTAGAG
GCACTCCGTAATTGTATTTCTTGCGCTCAGGACTCGCGAACCATGATAGCTCTCCGTTGTGACCCTTCGCAGCCGTAGCA
AGCGGATCCTGTCGTACAGCTCGATTGCCACCCGCCAGAGCTCCTCCACAATCTATCCCCCTGTCGACAGTCGTCAGACG
GATGGCGTTCAGGCCCTGTTTCTATTGACTGGAGGGGCCTGTTCATGTGCTGCTGGTTTTGTACCATTGGGCACCCAGAT
TTCTCTGCCGCTCTGCCATTTCTTTTTTTCTCTTCCTTGATCTTTCTCATCCCGCTGGCCGAAATCCCATACACGCTTTT
TGTATTCTTTTTTCCCTTCTTTTTTTTCCCTTCTTCCTTTTCCCTTCGTTACGTGCTCAGACCGGTTCTGCGAGCCCTTT
TTTTTCTTTACAACCTTTACCACTCTTTTTCTTCATTTCTGCTCCTGCTGCCGTCTTTTCGATATCTTCGACAGGGTCGT
TCTCAAGAGTTGCATTTTCATTTACACAACACACACATCTCCTTTGTTTTTTCCTATCCCCCCTCTTTCAACCCCACCGA
CGGCTAGACGACGGTACAGCAGCATCCTCATCCGGGTCCCATCCGAACGCAGACAGCTATATTCGACGGCCCAGGTTGGC
TTACGTAAACTTCAGTTGACAGGCGGCCAACACATTTACAACAATTTTACGAAGCATGAGCTGCTAGGACGACGAGACAT
CACACACTACCAGCCCCCGAGGAGGAGAATCTTGACGCCATGAACATCTTCCGCAACGCTCGCCTGAACCTTCGTCGCCA
GGGCCAGGCCGACACGGCCGACCTGGAGCAGCAGCAAACCCGCGAGGCCCAGGAAATGCGCGAGCCGCAGGCACGGTCCT
CGCCCATTAGCAGTGTGCTGCGCCGGGTCGGGCTGGCAGGCCGTGCACCCCAGCCGACGAGCAGTCCGTATGACGGCAGC
GCCGGCGAGACCGTGTCGCCCAAGACGCCGCAGTTCCAGGAAGACGTAGATTCCAACAGCCCGCCCTCGCGGCTTAGTCA
GCCGCCATCATATGACGATGCGAGCCGCCAGGACCCTCTAGCAATGCCGGCCGCGGCAGCGCAGCGCATGCGCAGCTCGA
GTGCGGGCAGCACGACGTCGGGCGGCAGCGGTCGTCGGCAGCGGCGACGGTTCGACGGCGCTGACCCGGCCGAGATGCGT
TTGGCAGACATGGCCGCGGACGGACGGCGGCGAAGGCACCGGCGCAGCCTGCTGCAAGACCAGCAGCAGCAGCAGCAGCC
AAAGAAGTTCCTCTTCTGCTTCCCGTACGTGCAGTCGCATCAGATGCGAGCGCAGATCTGCCGCTGCTCCGTGTCGGGAC
TGCTGTTGCTCCTGCTGCTGGTGATGTACCTGTCGCTGATGCTGACACACAATATCCACAACAACGAGTTTTCCGTGCTG
CTGCTCCTCGTCTCGCTCGCCGTCATCGTCCTCTTCTGCCACAGCCTCGTCCGCATCATCATTATGGTCGTGCATCCGCC
AACGCCCGAAGAGGACGAGCGCTTCCGCCAGCGCCGCGCGCGTGCTGCCGGCAGTACTGCCATGAGTGGCCCCGGCTACG
GCGCCTTTCCCCCTGGAACCGACCTATTCACGCCCGGCGGCTATGCCGTTCCGCGCCAGCCGATCCGTGTCGTGCTGGCC
CGCGACGAGGAGGCCGCCGGCGTCGAGAGCGTCGCTGCAAAGGCACAGCCACCGGCCTACGGGTTGTGGCGGGAGACTGT
GGTAGGTTGAGCCTGTTGGTCTTAAAGGTTCCTTTTTTTGGTTTCGGTACTGACAAGTCCAGCGTGTCGACCCCAACCGG
ATCTACTGGCAGCGCAACAACGAGGCGCCACCACGGACAGCTGGCGGTGAGAGCAACGGCAGCAGTCGCAGTCGCAGAAG
CAGCAGAAGCAGCAGGAGCATCCGAAGCAGCAGAAGTGTCGGTAGCAATGATGGCAACGGCAGCAGCCACGGCGAGCAGG
TCAACAGTAGCCGCACCAGGAGCACCAGGAGCACCAGCAGCACCGAGGTCGAAGCCAGCCTTGAGCACAGGCGTGGGGGC
AGCGGTGACGGGGTTGTCCGCCCACCATCGTATGCGTCCGAGGATGGTGTGAGCTACGTGGTAGAGGCTCAGCCACGGTC
GATAGCACCAACGACGGATGTGCCAACCCTGACGCACCCAGCCGAAGAGGGCCGCGTGGGCCAGCCGGCACAATGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62