GenePrediction:GLEAN_7223 Details

Name: GLEAN_7223
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3343440..3342601 (- strand)
Length: 840
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3343440..3343347 (- strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_140:3343267..3343092 (- strand)
Length: 176
Type: CDS
Source: GLEAN
Position: GCSC_140:3343017..3342601 (- strand)
Length: 417
>GLEAN_7223 class=GenePrediction position=GCSC_140:3343440..3342601 (- strand)
ATGTCTTCTCTTTCGCGTCGTGCATGCTACAAGTGCGGCAACGTCGGCCACTACGCCGAGGTTTGCTCGTCAGCCGAGCG
TCTTTGCTACAACTGTAAGCATTGCTGCCACTACTTCTGTGCACAACAACCTGCCTCGCCAGAAGCAGAAACTAACCTCA
ATTGTCGCTTTAGGCAAGCAGCCCGGCCACGAGTCCAACGGCTGTCCCCTGCCTCGCACCACCGATGCTAAGCAGTGCTA
TCACTGCCAGGGTCTCGGCCACGTTCAGGCAGACTGCCCGACGCTTCGCCTCTCTGGCGCCGCCACTGGCGGTCGCTGCT
ACAGTTGTGGCCAGCAGGGCCACCTGGCTGTAAGTTGTTCCGTTCCTTTGGCACAAGGCCATCCGTCAATCGTCCCTGTG
CTGCCAAGTTGACCCTTGCTCAGCGTGCTTGCCCGACACCCAATGCTGCCGGTCTCGGCCGCGGCGTTGCCCTGCCTCCC
CGTGGTGGCTTTGCCGGCTACGGCCGTGGCGGCTTCGCCGTCGGTGGTCCTCGCCCGGCTACCTGCTACAAGTGCGGTGG
CCCGAACCACTTCGCTCGTGACTGCCAGGCTCAGGCCATGAAGTGCTACGCTTGCGGCAAGCTTGGCCACATTTCGCGCG
AGTGCACCGCCCCCAACGGCGGTCCCTTGAACACTGCCGGCAAGACCTGCTACCAGTGCGGCGAGGCTGGTCACATCTCG
CGTGACTGCCCTCAGAAGAACACGAACGGCGAAGTCAGTGCCGAGATTCCGATCCCGATCCCGGAGGCTGCTGCCGTTGC
TGTTCCGGCCGTCGTCCCCTCCATCGCTCCGGTTGCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62