GenePrediction:GLEAN_7224 Details

Name: GLEAN_7224
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3330429..3328742 (- strand)
Length: 1688
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3330429..3330129 (- strand)
Length: 301
Type: CDS
Source: GLEAN
Position: GCSC_140:3330067..3328857 (- strand)
Length: 1211
Type: CDS
Source: GLEAN
Position: GCSC_140:3328795..3328742 (- strand)
Length: 54
>GLEAN_7224 class=GenePrediction position=GCSC_140:3330429..3328742 (- strand)
ATGCGTTTCTCCTACCTCTCCCTCACAGCGGCCTGGGCGTCGACTGTCGTGGCCTCGCCCCTGGTAAGCCGGGCAAGCAG
TGCGAGCTGCGAGAACACGGCCAGCAGCCGTTCCTGCTGGGGCGACTATAACATCGCGACCAACTACTACGAAGAGGTGC
CCGACACGGGTGTGACCCGCGAGTACTGGTTTGACATTGTCAACACGACCGCCTCACCCGACGGCGTGGAGCGTATCGTC
CTCTCGGTCAACGGCACAGTTCCGGGCCCAACGATCATCGCGGACTGGGGCGACACTGTTGGTACGTATACCTGTTTTGT
CTATAACACGCAAGTGCTGGTGGTTCGCGCTGACACATGCAGTTGTCCACGTGACCAACTCGATGGAGAACAATGGCACT
GGTATCCACTTCCACGGCATCCGGCAGAACTACACGAGCCAGATGGACGGCGTGCCGTCGGTGACGCAGTGCCCGGTGGC
GCCGGGATCCAGCCACACGTACACGTGGCGGGCGACGCAGTACGGCTCGTCCTGGTACCACTCGCATTTTTACGTGCAGG
CATGGGACGGAGTATTTGGCGGGATCGTGATCAACGGCCCTGCCACGGCCGACTATGACGAGGATCTCGGCTCGCTCTTC
CTCAACGACTGGACGCACGAGACGGCCGACCAGGTCTTGCTCAAGGCCGAGGCGTCGGGGCCGCAGACGCTGGACAACGG
CCTCATCAACGGCACCAACGTCTACACCACCACGGACGATACCGTTGTCGGCTCCCGCTTCGAGACCCAGTTCAGCGAGG
GCAAGCGGTATCGGCTGCGTCTCGTCAACGGCGCCGCCGACACCGTCTTCAAGTTCACCGTCGACAACCACACGCTCGAG
GTCATCGCCACCGACTTCGTGCCCATCCAGCCCTATGCCACTGACGTCGTCAGCATCACCATGGGTCAGCGCTACGACGT
GATCATCACGGCCAACGCCACCACGGACGACTATTGGCTGCGTGCCATCCCTCAGACCAGCTGCAGCGACAACGCCAACG
CCGACAACATCCGCGGCATCGTCCGCTACTCTAGCTCCTCCACGGCCGACCCGACCACGTCCGCCTGGGATGCCGCCGCT
GTCGACAGCTGCTACGACGAGGATGCCTCTCTGCTGGTGCCCTACCTCGCCATCGCCGCCTCTGACGCTGACGTGACCGA
CAGCTTTGACGTCGAGGTCACCCTAAGCAACAACGCCTTCCTCTGGGAGATGGGCTCGTCTACCTTTGTCAACGAGTGGG
ACTACCCGACCCTGCAGCAGGTTGCTGACAAGAACGACACCTGGGGCGCTTCCCAGAACGTCTACGAGTTTCCCAATGCC
GACACCTGGGTCTACTGGGTCATCCAGACCAAGAACAACGCGCCCCATCCGCTGCACATGCACGGCCACGACTTCTGGAT
CCTCGGCCAGGGCACCGGCACCTACAACGCCAGCACGGCCAACCTCTCTCTCGTCAACCGTCCTCGTCGTGATGTCGTCC
AACTGCCCGGCGATGGCTACGCCGTCATCGCCTTCTATACCGACAACCCAGGTGTAAGTCTGATCTTGCCGTCTTCTGTC
GTCTCCCCTCCTTTTCGTCTTCGTTTGCTGACAGCACAGGCTTGGCTCATGCACTGCCACATTGCCTGGCACACCACCGA
GGGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62