GenePrediction:GLEAN_7229 Details

Name: GLEAN_7229
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3294291..3292699 (- strand)
Length: 1593
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3294291..3294062 (- strand)
Length: 230
Type: CDS
Source: GLEAN
Position: GCSC_140:3293992..3293847 (- strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_140:3293665..3293335 (- strand)
Length: 331
Type: CDS
Source: GLEAN
Position: GCSC_140:3293260..3293171 (- strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_140:3293111..3292860 (- strand)
Length: 252
Type: CDS
Source: GLEAN
Position: GCSC_140:3292771..3292699 (- strand)
Length: 73
>GLEAN_7229 class=GenePrediction position=GCSC_140:3294291..3292699 (- strand)
ATGGCCTCCAGTGCAATGATTACACCGCCCCCCAGCCGGTCCGGCACGCTCACGCCGCCGGATGCTTGCTGCCTCGACCA
GGCGCAGGCTGCCGACAAGCTCCAGGAGTATGCGCACGGCCGGTGGATCAAACTGCCGGAGGCGCTATTCTCGTCCATCA
TGTCGGTGGAACCGGAAATCAACCCCATGCACAGAACCTCAAAGGCACAGTCTGACGCGTGGCTGCGGAAGTAAGGAGGC
AGTCCTGTCTGAAGTGTGTTTCTGGCGCAAGAGATCGCGACAATGCTGACTAAGAACAGTGCCCTGAAAATGGACGACAA
GACAGCCAACATTTGGGACCGGCTGGACATTGCCTACATGAGCGCTATCCTGGCACCGCACGCCGATGCCGAGACGCTGA
AGCTGATGAACGACTGGAACGGCTGGGTGTTTGCCTTTGATGACCGTAAGTTGCAATTCCAGCACCCAGGATCAGATGTT
GGGGGCCATTGGGGGCTGCGATCAGACGTTGGGGGCCGCGCTACTGTGCGTCAGGCCTATTAGAGCACATTTCGATCTGC
GGCAGGCCACTAACATTTACCGAAATTGCGCATGGACTCCGCTGACTGGAATGACGTTTTCTGCAGCTTTCGACGAAGGC
GACTTTGCCAGTGACCCTGTCAGGGCAGCCGAGGAAGTCATCTACACACTCTCCATGCTGGATGACGTTCATCCGGTAGT
CTCTGCAGAGGAGAATCCGCTGCGGCATACGCTGCAATCCTGCTGGATGCGTTTCAAGGAGCGAGCCAGCCCCAACCTGC
AGTACCGCTGGAAGCGGCACTTGACGCTGTACTGCGTCGGCGTGTTGCAGCAGGTTGGTATTCAGAACAAGGCCTCTGCC
AGCCGGCCAACAGTCGCCGAATACATGGATATGCGTGCGGGCTGCGTGGGAGCATATCCTTGCATTGGCCTCATGGAGTG
AGTGCGCGCAAATTGCGACTGCGCAATTTGGCTCGTCTTTCCACTTACAGCGCTAACTCGCTGTAACATAGGTACGCTGA
GGGCATCGATATACCACAGCACGTTATGGATCACCCGTCGATGCAGGCCATTTCACGGATTACATGCGACCTGGTCACGT
TGTAGGCAATCTCCCATTTCCTGTCGTGTTTTATTGGCTCCAGACTGACAGCTGCGATAGGCAAAATGACCTGTGCTCGT
ACAAGAAAGACCTGATCAAGGGTGAGGACAGCAATATTATGTTTATTCTCAAGGACCAGGGAATGAGCGACCAGGAGGCC
GCTGACCAAATCGGCGAGATGCTGTACGGCTGCTACCGTAGATGGTTCGATGCGTTGAGCCATATGCCGTTCTGGGGCGA
GAAGATCGATCGCGACGTTGTGAAATTCGTCGAAGGTTGTCGCAATATCGCCCTTGGAAACCTGCACTGGAGGTAAGACT
TGCGCGCAGCAGAGCGTCCCCGATTCCTAGCCGTGTTTTTCTTTTTTTCTTTTTGTTTTTGCTCGACTAACATCTTCCAG
CCTATACACGCCCAGATACTTGGGCAAGGACGGCCCAGAGGTGAAGCGAACGAGAATGATGCAGCTGCCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62