GenePrediction:GLEAN_722 Details

Name: GLEAN_722
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1641494..1642751 (+ strand)
Length: 1258
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1641494..1641736 (+ strand)
Length: 243
Type: CDS
Source: GLEAN
Position: GCSC_97:1641792..1642751 (+ strand)
Length: 960
>GLEAN_722 class=GenePrediction position=GCSC_97:1641494..1642751 (+ strand)
ATGTTAGAGATTGTCGATCAGCCGCGGCCAGGCGGGCACTCGACCACGGCAGCCACGGGCGCAAAGGTCACCACGGCCGC
TGCATCCGACCGACAACTCGCCGACAGCAATGGCAACGTGGTGGCTGGCGCCGCTGCCGGGGCCGAACCCCTGCCGGTAG
CCATCATCGACGGACAGATCGACAAGCAGAGCTTCTCGTACGTCTGGCGGACTGGTGTCGCAGGCGGCCTGGCTGGATGT
GCAGTAGGTTGATTCTGTTTCACCCATATATCTCCATACAGCGTACACTAACCTTTAGGCAAAAACGATCGTGGCTCCCC
TCGACCGCGTCAAGATCCTCTTCCAGGCCAGCAACCCGCAGTACGTCAAGTACTCGGGCTCGTGGGCCGGTGTCGCCCAG
ACCATGCGCCTCATCTACCAGCAGGACGGCCCTCTCGGCCTCTTCCGTGGCCACTCCGCCACTCTGCTGCGCGTCTTTCC
CTACGCTGCCGTCAAGTTTCTCGCCTACGAGCAGATTCGCTCCTTCATCATCCCCCGCAAGGAGCACGAGACCCCGCTGC
GCCGCCTGCTGAGCGGCTCGCTGGCCGGCGTCACCTCCGTCTTCTTCACATACCCGCTCGAGCTCATCCGCGTACGCCTC
GCCTTTGAGACCCGTCGGGACACTCATTCTTCGCTCCTCTCCATCTGTCGGCGCATCTACGTCGAGCATCCGGCGACTGC
GATCGCAACCGCAACCGCCACTGCAACCACAGCCACAACCGCCTCGTCAATGGCAAAAACACCATCTCTTGCGCCTCCCC
GCTCCGGTATCATCAATTTTTACCGCGGCTTCTCCCCCACCATCCTCGGCATGCTGCCCTACGCCGGCATGTCCTTCCTG
ACCCACGACACTTGCGGCGACCTGCTGCGCCTACCGCTGGTAGCAGCCTGGACCACCCTCCCCCAGCCCACCAACGCGCC
GCCCGGAAAGCCCGCTCCTTTGCGCGCTTGGGCCGAGCTGCTGGCCGGCGGCATCGCTGGTCTCGTTTCCCAGACTGCGT
CCTACCCTCTCGAGGTCATCCGCCGCCGCATGCAGGTCGGCGGCGCTGTCGGCGACGGCCATCGCTTCAACATTGCCGAG
ACCGCTCGGCTGATCATGCACGAACGCGGCCTGCGCGGCTTCTTCGTCGGCCTGACCATTGGCTACGTCAAGGTCATGCC
CATGGCTGCCGCAGCCTTTTACACGTACGAGCGGCTAAAACGGCATCTTGGCGTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62