GenePrediction:GLEAN_7230 Details

Name: GLEAN_7230
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3291940..3291285 (- strand)
Length: 656
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3291940..3291651 (- strand)
Length: 290
Type: CDS
Source: GLEAN
Position: GCSC_140:3291483..3291285 (- strand)
Length: 199
>GLEAN_7230 class=GenePrediction position=GCSC_140:3291940..3291285 (- strand)
ATGGGTCTTGCCGTTACGAAGTCGCTGCTTCTGCAAGGCTGGATCGTTGCAATCATTGGTTCTGTCGTAGACGACTCGGA
GATTGCCGACGAGATTGGCGCTGAGTCTTTCCTGGTCAATGTTTCCGACCATGAGCAGCCAGGTAATGCGTTCCCCGGGG
TATTTGCGCTACACAACCTCCAGGTCGTCCAGGCATGGACCATGTTTAACAAGCAGTGCCAGTGCCGGAATCGCCGATCA
CGAGCTGTTTTGGGACCACAAAGACATGGATCTGGCTTCCCCTCTACTCCGTAAGCCGGATATCGCTTCGTTGGCCATCG
ACCTTGACAGTGTTATCGTCACGTGCTACCTTGGAATGCATATTCTTCGGAAAGGCGAGAATGAAGTAGACAAACGCATT
CCGATCACGGTTTCGACCGGACCCTTTTGTCCGTACAGAGACAAGCCGTATCTGCAGCAAAGCATGCCTGTGTGGGCTTC
CTGCGCTCAATTGCCCCGAGGCTCTTTGCCACGACGGCATCCGGATCAACTGCATCAACCAATGTAACGTCTTGACGGGG
CTGGTGAGCAGCACCGGCTGGTCTCTCTTCCCAGAAGGAAGCGATCACGCCCCTGAGAAGATTGTCGAGGTCATTACAAC
GAAGATCACCGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62