GenePrediction:GLEAN_7231 Details

Name: GLEAN_7231
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3288186..3287107 (- strand)
Length: 1080
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3288186..3288042 (- strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_140:3287970..3287663 (- strand)
Length: 308
Type: CDS
Source: GLEAN
Position: GCSC_140:3287612..3287476 (- strand)
Length: 137
Type: CDS
Source: GLEAN
Position: GCSC_140:3287272..3287107 (- strand)
Length: 166
>GLEAN_7231 class=GenePrediction position=GCSC_140:3288186..3287107 (- strand)
ATGAACCTTCCCGTCTACATCTCCGACGACTGCGGAAACATTGAGGCGAACCAGTCGAGCAAACCGCCATCACTGGCTAT
TACGGTTCGATTAATCCTGCACGACGGCAACTGCAGGAGGAAGACCACTCCACACGTTGCCCATGGTGTCTACGACGCAA
TCAATTACTTATAAGAAAGAGGGATCAGCATTGTTTGCTGATTTACTTCGCAACAGCGTTCGTCCAGGTAGATAACCGCA
TCTCAACTGCTGCGCAGACGAAAGGCGCCAGGAACAGCGCGACCTCGTTGTTACGCAACGCCGCTTCTTCCGGAGCGCTC
CCGCCAGTGGGCTACTCTCTGTCTCCGGCTGAGGCTGGCCTGCAATGCTTAGCGTCTGCCTCCAGTGCCTTCGGCCGGGT
GTGCACCGGCGACCTGCTAGAGGGGACCTATTCGCGGGACGGTGCCCTGACTACTCTTGTGGACGAGGCGCGAAATCAGA
CCCGCTTGTCTACGGCTTCCTTAGCCCTGCAGCGGCTGACTGCCGTAAATTCCGTTGGGGGCCCAGCGGTGCTTTCGCTT
CTAACCGCGTCTAGGCCGGGCAGCTACTCTTGCCTACGTATTCTCTAAACCCGGTGCTGGATAAGCTGGCAACATTCGTG
GCCACGGCGGCCACGGCGGCTCCCGACATTGCCCAGCTCCTCGTCGCGGCTCATGCGTTGGACTCTTCGTGGTGCGTTTG
TCTTAACACTAGGATTGTGCTATTGCTGTTGTGGCCTTTTAGCCCGTCGGATCACTGCTCCCCGATGGTAAAGCCCTTAT
GCCCAAAAACGCCTGCGTGGTTAGTGAGCAGTGGCGTGGCCGTGCTGACTTCCAGAACGCGCTGGCTGCACAATTCCGAG
GTAGGCATTAGTTGGGTGGCCGCTCGTGAGGCAGTTCCACCTTCATCACGCTGGCCGATATTCGCGACACCAACGTTGCG
GCAGTGCAGTCGACTCCAGCGTTCGGCTCAAGGACTGTAGCCACTTCGTCCGTGATTATGACGCCGCACCCGACGATTAT
GCCCCCTCGACCCCCTCCGCACGTCAGGGTGACTCCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62