GenePrediction:GLEAN_7232 Details

Name: GLEAN_7232
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3286044..3284656 (- strand)
Length: 1389
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3286044..3285664 (- strand)
Length: 381
Type: CDS
Source: GLEAN
Position: GCSC_140:3285400..3285386 (- strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_140:3285316..3285163 (- strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_140:3285095..3284656 (- strand)
Length: 440
>GLEAN_7232 class=GenePrediction position=GCSC_140:3286044..3284656 (- strand)
ATGGCTGGAGTGACGTCCGACTTCGCGGCCCGGCTTGTCTTCTTGATGCACCAAGCCACGGCCAACTCCCAGCATGTCCC
AGGTGTTGTCCTGCAGGTAGTCGACCGTCATGGCAATTCGGCCTATTCCGGTGCAGCAGGTCTGAAAGGGCTCGGATCCA
CTAAGCCTATGACGACCGACACCGTATTCTGGATAGCCTCGTGCACGAAGCTGGTCTCGGCAGTTGCCTTAATGATCCTG
GTCGAGCAGGGCAAGGCCGATCTGGACTCAGCAGACCTATTGGAAGAAATGGTCCCCGAGCTGAAGACGGTACAAATTCT
CGAGGACGGCAGGCTTAGGCCAAAGCGTAACCGGATCACTTTAAGGATGTTGATGACTCATGTCAGCAGCCAGACGGCCT
GTCTACGAAATACTGCACCAATAATAGCTAACGTGGTTTAAGACAGCAGGATTTTCATACTCATTCTACCATGAAGATCT
TTGGCGAAGCCATTTCCACATGGACGCATTAATGGATGAGTTCCAAGGAGACTTCTCTGGCATACAGCAGCCACTTGTCT
TCGAGCCAGGCACCAGCCATGATTACTCAGCAAGCTTTGCCGCTTCTTCCTGTTCGATGCATGTGCTAACAAGGCTTTAT
ACAGGTCGGAATTGACTGGGTTGGTGTTTTCATAGACCGTTGCGCGAAGACAACTCTCGAAGAGTTTTACCAAACTAACA
TCTTCCAGCCCCTGGGAATGACCAGCACAAGCTTCATGCCCTCTACAGACATGCGGTCTAGAATGGCCATGTTCCACCGG
AGAGCAGATAATCTGACTGCAGAGCCGCATTTCTATCGTCCAGCTCGGGAAGAGGGGCAGGACTACTTCCAGTCTGCCGG
TGGTCAGTGCAGCACCGCACACTTTTTCTGCCTCCCTTCCGCATCTGTGTTTGCCTGACTGGTATGCAGCCGGACTTCTG
AGCACCGTGACGGACTACAGTCGAGTGCTGGCTATGCTCCTCGGCGACGGTGTATCGCCGCACACACAGAAGAGAGTTCT
GGCGAGCGAGACTGTCGACGAGATGTTCAGGAACCAGATACCTGACTACATGGGAAAATACGTCACCGGTGGTCCGCACG
TGACGAGCAGACCCGATCTTTGCATACGCGATGACCCGACAGCAGAACCGACCGAGGCCTTGGAAACTTACGGCTGGGGT
CTCACCATGCTTCTCCAGACCAGTCCAGGGGCTGCCTCATTTACCAAAGGCTCGGCAACAGGTCTTTGCAACTGCTTTTG
GACTGTGGATCGAGAGAAGGGGGTTGCAGCTGTATGCTTCTCGCAAATTCTGCCATTTGGTGATCCCTACGTATATCCAC
TATGGCAGGCAGTGGAAGCAGTCATATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62