GenePrediction:GLEAN_7235 Details

Name: GLEAN_7235
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3261221..3260175 (- strand)
Length: 1047
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3261221..3261171 (- strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_140:3261099..3261012 (- strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_140:3260942..3260704 (- strand)
Length: 239
Type: CDS
Source: GLEAN
Position: GCSC_140:3260624..3260175 (- strand)
Length: 450
>GLEAN_7235 class=GenePrediction position=GCSC_140:3261221..3260175 (- strand)
ATGGCTGTCCAGCAGCACGTCCTCAACTGGCTGTACAGTGTCCTCACCAGTGTAATTAGCTCCGCCCATCTGCTTGTCCC
CTCTCTCTCTCCTCCGAAAGTCTGACCCCCCCCCCCCTTCAGGAATACCAAGACGTCAACCGCACCTACAACGATGTGGC
CCAGGCCCTCTCCCAATTTCCATCCCTGTCGCCGCGGACAGACGTCCACAGTATGTCTTTCCGTCGGCACCCCGGCGTTC
TTGGTGACATCCCAGCCTCGCTGACTGACTTTCCTCCAGCCTTTTCCAATGGCGCCTCGGCCCTGCTTCTCCACCTCTCC
GGCACCCTGCCGGCCGTCTTCCGTGGCACTACCTACCGCTATCCCATCTCCGTCTGGGTCCCCCACGCATACCCCCGCGA
GGCGCCGCTCGTCTACGTCACGCCGACCGAGAACATGATGGTCCGTCCTGGCCAGCACGTCGACCCCCAGGGCCAGGTCT
ACCACCCCTATCTCGTGGGCTGGTCCGAGTTTTGGGATGTGCGTTTTGTGTCCTGAACCCGTGAAGCCGGGACAATCTAT
TGACGGCTCTGCATGCTGACAGCCGCTCCGCTCGCAGAAATCCAGCATTGTCGACTTCCTGGCCATCTTGCGCGATGTCT
TCGCCAAGGAGCCGCCTGTCATTGCTCGCCAGTCTGTCCGGCCATCGCCTTCGACTGCCGCAACACCATCCCCTCCACCC
ATTCCACCCTTCCCGCAAGAGCTGGCTGCTCACCATTCTGCTGCCGCCTTCCAGCTGCCGACACCTCCGCCCAAACCCAG
CGCCAACGTCACCACTACCACTAGCACCACTCCCCCAAAACCAGCCCCACGCCGTCTCCGCCTCCGGTTCCACCCCATCC
GCATGCTGACTCCTCCGCTGCTGCCAACTCCATTGCGGGAATGCTGCACGATGCCCGTCTCAGCTATACTGGCACTGCCA
TCCAGACTCCCCACTCGCCGTCTCCTCCCCCTCCCCCACGACCACCACCTGTGCCCGGCAGGCCCTCATATCAGCAGTCT
CCTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62