GenePrediction:GLEAN_723 Details

Name: GLEAN_723
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1649075..1650595 (+ strand)
Length: 1521
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1649075..1650265 (+ strand)
Length: 1191
Type: CDS
Source: GLEAN
Position: GCSC_97:1650317..1650595 (+ strand)
Length: 279
>GLEAN_723 class=GenePrediction position=GCSC_97:1649075..1650595 (+ strand)
ATGCCGAAAGCGATTTCCCCCATGGCATCGCGCCAGGCGGCGCGGCGGCACAATCCCCTTGACGAAGACCTTTTAGCCAG
AGGGCTCCTGCGGCAAAAGGCGCCAAAGCGAAAGGCAGGCGAGGACAAGGACGGGCAGGGCGAGGGCTACATCGATTCGA
AGGCGTCGAAGCGGATTCTTGCGCTCGGCCGGGAGCTGGAAGTCGAGGGCGACGAAAAGGCTGCAAACGGCACAGGAAAG
CAACAGCTGGATGCCTTTGGGTTTGGAACACGGTTCGAAGAGGAGGACGAGGAGGCTCCGTTTGACGATCACGATGAGCA
ATGGGCAGACGAAGACGACGGAGACGCCGGCGACGGAGCGGGTGAGATCGATCCGGCCGACCTGGCTACGTTTGACAAGT
TCCTCCCCAGCCACCAGGAGGACGACCCAATACTGAAGCACCTGAGCCTGCGGATGTCGGAGAAAGCTGGGGCCGAGGAG
GATGTTGGAGAACATATGGACGAGGCGGAACAGTCGGCACAGCCAGGCCGCAATCTGGCAGACATCATCCTGGCCAAGAT
TGCCGAGCACGAGGCCGGCCCGCAGCAGCGGTCCGTGGCTGGCGGGGCGTTTGACGAGGAGGGCGAGCTGGACCTGAACC
CCAAGGTGGTGGAGGTGTACGCCAAGTGCGGCATCCTGCTGTCGCGATGGAAGTCGGGAAAGCTGCCGAAGCCGCTGAAG
ATCCTCCCGACGGTGCCACAGTGGGAGACGTTGATTGAGATCACGCAACCGGAGCAGTGGACTGCTAATGCCTGTGAGGA
GATGACCAAGATCTTCATCAGCGCCAAGGCTGAGGTTGGTCGACGCTTCCTGGAGATGGTCATCCTGGACCGGGTGCGCG
ACGACATCCGCGACACCAAGAAGCTCAACGTGCATCTGTTTGCGGCGCTCAAGAAGGGCCTCTTCCGGCCGGCCGCCTTT
TTCAAGGGCTTCCTCTTCCCGCTCGTGCTGTCGGGCACCACGACGCTGCGGGAGGCCCAGATCATCAGCGCTGCGCTCGT
GCGCACGTCCATTCCCGTGCTGCACTCGGGTGCCGCGCTCAAGGGTCTCTGCGACATCTCGGCCGAGCTGTCTCCCGACA
CCGAGGGCCAGTCGGCCATCAGCATCTTCATCAAGGCGCTGCTGGACAAGCGCTATGCTCTCCCGTACCAGGTATGAAGA
CAGCCAGCCCCGTGAGACGACACAGCAGCTAACCTCGATCAGGTCATTGACGCGCTCGTCATCCATTTTCTGCGCGCGCG
GGCCGCTGATGCGATGCCGGTCGTCTGGCACCAGAGCTTCCTGCTGTTCGCACAGCGGTACCACGACTCCATCACCGAAG
ACCAGCGCGAGGCACTACTGGACCTGCTGCTGACGCACACCCACGCCGCCATCGGGCCAGAGATCCGCCGCGAGCTGCTG
GCCGGACGCGGTCGCGGCGTGCCCCTGGAGCCAAAGGGGGCCGACTTTGACGGAGACGACACGATGCTGATAGACGCCTG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62