GenePrediction:GLEAN_7241 Details

Name: GLEAN_7241
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3242007..3240774 (- strand)
Length: 1234
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3242007..3241990 (- strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_140:3241910..3240774 (- strand)
Length: 1137
>GLEAN_7241 class=GenePrediction position=GCSC_140:3242007..3240774 (- strand)
ATGCAGCTATCCATATGCGTACGTAGTAACGGCAGCTCGTTTTCTGGGCGGTCATTGTAACCCATTCTCGTTCTGGTATC
TCTACGACAAAACCGAGGCACTCGCAGCTGTTGTTGTAGAAGTGGACAGCACGATTGGCGAGAGGCACATATACTTCTTC
CGTCCAGGGCCTCGGCCCAAAGAGCTGGCAAAGGCTGCGCATAGGGACGACAGTGACTATGGAGCTGCACCTCCCCAGAC
CCGAGCTTACCAGACTCGCACGGGGTTGCATTCGATAACAACAACAGATCCGCTAGCTACCAACGCTCAGGGGCCTGTTC
CGATCAACACGGTCCTCGTTCTCCAGTCGTTGCACGGACATGAGAAGCTGGTGGTGAGGTTCTGTGCCGAAGCTGTCGTC
GATCCCACGGAGATGACGGCGTGGCAGGCACTACGCCTCGTGGCCACAACGTGGTGGCTCGGATTATTTGTTGACCAAAA
GGAGGTAAATCTGGCGCAGAAGAAAAAACCTCGCACAGCAGACTGGATAGAGCTCCGGCTCGAGACGGCCTTTCGACGCT
ACCTGCAACACGTGGTCGAGAAGCAAGCAACGACGGCGGCAGCGCCGTCGCGGCGACTAGCTGTGACGTACATTCCGTGT
GGGATCCCGGGGGTGGCATCAGAACGAATACTCTCTGGCACAGCTGCTGGCCAGCAAGACAAAGACGTGGACGAGGTGGA
GATCCGGGTTTTGACGCCGGTTTTCTACAGACGGTTCGTGTGCTATGCTCACGACGTCGAGGCGCTCTTCTGCGAGCTGC
GCGAGAGCTGCACGATTGACGTGTCGCGGCCGGAGCTGCTGGCGAAGCTGGTGCTGGCCAAGACGCCACGACCGCCACTG
CAGGTGACGGGAGTCATCGACTTTCTCTTCTTCAAGGCCATCCAGAGGCTGCGACGACGACCGGAGCGTCTCGCCCCCCC
CGCAAAGTTGCCGGGTGCAGCTTCTTCGTATGTTTCCACGGGCGATCTCCGGGGCTTCCGGCTCTCTGCCATGGACGGCT
TCGTGCTCGCCCTCAAAGACGAGGCCGGTCGAGACTTGCGCAGAAGTTACAGGGCCACAGTTCTGGCCGTATTTCTGGCA
GACAGGACAGCGCTCGGTTCCTACCGCGTCTTCCAGGCCCAGTGCCTCCTGGTGCGGCTCCTGGTGGCGTGGGCAGCAGT
AGAAGTGGTCCTGTCAGCTTGCAGTCATGGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62