GenePrediction:GLEAN_7243 Details

Name: GLEAN_7243
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3233582..3232438 (- strand)
Length: 1145
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3233582..3233463 (- strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_140:3233406..3232438 (- strand)
Length: 969
>GLEAN_7243 class=GenePrediction position=GCSC_140:3233582..3232438 (- strand)
ATGGAGCACGAGGCGATGCTCACGGCAGATGAGCAGCTGCACCGCTCTCACGTGGAGCGGTCTATGCGTGAGCTCCAGCG
CATGGTTGCCGACAGCGAGGATGCTCTAGCCGAGGTGGGTGTATGTTTTATGTTTGTTCATCGTCTTGGCAGAGAGGCTG
ACAGATGTGCATGCAGCTCCGCAGCCGAGCCGTTCCTCTGCCACGGTCGGCGGCGACGTCGCTGGCCGTCATGAAGGCCG
GCTACGACCGGGCGACGGTGTCGGAGCCGTTTCTGCCGTATGTCGACTCGGTGCTGCCGGCGCTGCTGGCGCTGCGCAAG
ACGCACGAGGTGGCGGCCGAGTCGTGGGCGCACGTGACGGCACAGGAGGAGCCGCAGCTGGCGGCAGCGCGACGACAGCT
GGCGGCCGAGCAGACGCGGCTGGACGACCAGAAGGCGCTGAACCGGGCGCTGGAGGGGCGGTTGGCAGCGCTGCGCAGCA
GCCAAGAGGCGCGGCAGCAGAGCCCAGCAAACACAGAAACGACGGCCGAGCAGAGACGCCAGCAGAAGCTGGAGGCACTA
AAGGCACAACGACACGGCTACGACACGGCGACGTCGACGCTGCTGCGAGCCCTCCGCGGCTTCATCCACGAGCGGCTGGG
ACCGATGCTGGCGGCCGAAGAGCTGGGCGGCCCCGTGGTCGGCGCCATGGTGGACGTGCGGGCAGACGATCTGGTGGCCG
GGTTCAGCGCGCAGGGAAAGCCGCGGCGTCAGCGGCAGCCGGGGGGAGAAAAGGGTGCAAAGAGCGCGAAGAGTGCGGCA
GCTGGCTCGCGCGACGCAAAACGACAGCAGCGGATCGACGAGATCTGGGGGCCACGAGCAAACGACAGAGACGGGGGAGA
GAAGGAGGACAGCGATGACGACGATGCAAACGAAAAGGACAATCGAGACGAGTCAGCCACAGCTGGCGCGGAGATGCAGG
ACCTCACAGAACAGCTTCTGAACACGTTGGCCTCAGCGGCTGGCGATGGGTCAGCAGCCTATGTAACGCTTCCACGCGAG
TCGGCAGCTGCCCGGTTTCTCGTGCGGTCAAAGGTGGCCCAGTTTCACCCGCGCGATGCCACCCGACTGCGCCTGATTGA
TTTTGGCCGCGAGCTGGACGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62