GenePrediction:GLEAN_7244 Details

Name: GLEAN_7244
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3232383..3231544 (- strand)
Length: 840
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3232383..3232187 (- strand)
Length: 197
Type: CDS
Source: GLEAN
Position: GCSC_140:3232095..3231978 (- strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_140:3231837..3231544 (- strand)
Length: 294
>GLEAN_7244 class=GenePrediction position=GCSC_140:3232383..3231544 (- strand)
ATGCAAACCCCTCAGCTACTTCGTACAGGCTGCCAATTCGCCTCAGACTTCACGGGAGAGCAGACAAGGGCGGCTCATCG
GCAGATCGTGCCCATCATCTCCTCGGACATGACAGCCGGAAGGAGGATAGCTCAGGATAGCTGGCGCATGCTTGCTGGCA
GTGGCAATGAGCATCACGACTGGGCAGCCGTTTTGCCGTGAGTTTCTGACGGCAGCCCTACACGAGACAGCACAGCGACC
GATGAGCAGACAAAGGCCAGGACGAGCAACCTCGGTTATGGCTGCTAGGCAGGGCGTCGCGTGGATTGACAATCGTGGCC
GAAAACTGCGCATGGCATCACGTTGGCCAGACTTTCTTTTCTTTTTCCTCCGAGACCAAGCGGCGGTGGACTCCGCTAAG
GCCGAGGTCAGCGTATGAAGATCACTGAGATGCTGCCATCTCTCACCCCTTGCGGCCTGCCCGCCTTTGTTCTCCTGCTG
GCCGCTACGGAATGGGAGTAAACAACACGGGCGTGCGGGCAACACGCAGACACGTCCGACTTCCAGCCTAACGCCTCTGT
CTGGTCTGTTTTCCGCGAACAGGACGGAGCCGAGAAGCATCGCATCATTGCATATGGCTCTAGGAGTGCTAGGATGAGCG
ACACGGACCGATTTGGCGAGGGAAGCATGCCGGCCGGTATACAGGAACTGCCGATCGAGCAGAGGCGCCGAGATAGGCTT
CTTGCACATGCCTCCATACACAGCAGCAGCCGGCACACGAGGCAGGCCCGAGGATGCACACAGCAGCAGAGTGGACCGAT
GGAGAGAGTGGGGGCCAGAGGCGGCGGGCTGACCAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62