GenePrediction:GLEAN_7245 Details

Name: GLEAN_7245
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3230729..3229981 (- strand)
Length: 749
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3230729..3230561 (- strand)
Length: 169
Type: CDS
Source: GLEAN
Position: GCSC_140:3230494..3230222 (- strand)
Length: 273
Type: CDS
Source: GLEAN
Position: GCSC_140:3230153..3229981 (- strand)
Length: 173
>GLEAN_7245 class=GenePrediction position=GCSC_140:3230729..3229981 (- strand)
ATGAAGTTTTCCATCTTCTCTACCGTTGCCTGCATGGCTGCCAGCGTCTTTGCTGCTCCGGCTGTCGCGAACACTGGCCT
CGTCGCCAAGCCCGATGTCGTCAAGCGTGACATCCTGAGCACGCTCACGAGCGCCCTCACGAGCGCCGTCAGCGAGGCCA
GCTCCATCTGTAAGATTTTTCTAATCCACAGAGCAGCACCCCCCACGACTCTTTGCTGACAATGACCTCTTGTAGCCTCG
GATGTGTCGTCGCTCGCTTCGGGCTCGACCACCTCGCTGACCAAGATCTTCGAGGACATCACCGGCCTCAACAAGACGCT
GACCATCGTTGTCGACGTCATCGAGGAGCTCAACCTCGACGCTGCCGACGCCACCATCACCGTCATCGACGGCCTACTCG
GCCTCTTCGGCTTCAGTGGCGCGACCCAGATCAACTCCCTGCTGCTCAGCCTCGAGGCCGGCCTGAAGAACATTCTGGAG
GAGATCAAGAAGCTCGGCTCCGGCTCTGGTAAGCCAGTTTTTTCTCTTTTTCGCCAGCCCCTCACCCGCAAGATGTATCT
CGCTAACCCCTCCCAGACCTCTTTGACGAGCTCGAGACCGTCGCCCAAGTCCTGGGCGGCTCCGAGGCCGAGGGTGCTCT
GTCTGATCTCGGAGGTCTCATCCAGGACGTGATCACGCTCATCGGCGGCATCCCCATCATCGGCCCGGTCCTCTCGACCC
TCATCACCGACCTGCTCAAGTCGATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62