GenePrediction:GLEAN_7247 Details

Name: GLEAN_7247
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3221370..3219625 (- strand)
Length: 1746
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3221370..3221320 (- strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_140:3221262..3221229 (- strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_140:3221174..3219625 (- strand)
Length: 1550
>GLEAN_7247 class=GenePrediction position=GCSC_140:3221370..3219625 (- strand)
ATGTCGATCCATCCATCGCGTCTGGCGTATGTGGAGGATGCAGAGGACGTGGTAGGTTGTCTGCGCCGAAGCTCTGGGTT
TGCCTGCCATTGTGCTGACGATGGACAGGACCGACGAGGCGGCATCGACCTGGCAAGCGTCCGTACGTGAGCAGTCCTTT
TTTTCCGTTCCACGGCAGACAGCAACTGACCTGCAGCACTCGAGCATGACTACGAGATGCCGGTGACGGCATCGGGCATG
GCGCCCGAGAAGGCGTCGGAGCTGCTGGCGCAGCTGGCACGAAAGAAGATTGCGGCGACGATCGCGGTGCCCAAGGAGGA
CGGCAAGGTGCGGGAGCGGCTGCGAGAGCTGGGCGAGCCGGCGACGCAGTTTGGCGAAGGGCCAGCCGACCGCAAGGCGC
GGCTGCGGGAGCTGCTGGCGATCGGCGTGGAGCGAGAGCGGGCGGCAGCAGCGAGCAAGGCCCAGGGCGGCGAGGACGTG
GCCATGGACGACTACGCAGACGGCGACGGCAGCAGCGACGACAGCGACGACGACGGACCACAAGAGTTTTACACGCCGGG
CGGATCGGCTCTGCAGCAGGCTCGGCGCAGCCTGGTCGACTACTCGCTGCCGCGGACACAGCGCCAGATCGCGCTACAGC
GCACCGAGGCGCACATCCCGCTGCGCAGCCAGGTGCGGTTCCGCGACCAGGTCAAGACACGCCTGCGCGGCTTCGAGCTG
CAGGCCAGCCAGCCGACCGGCGACCGCAACATCAGCATGACACGCATCGCACCGGGCGGCCAGCTGGTGGCAGCCGGCAA
CTTTGGCGGCTCGCTCGGCCTCTATGGCGTGCCCAACCTCGAGCTGCAGCGCAGCCTGCGCGGCCATACCGGCAAGATCA
GCGGCCTGTCGTGGTTTCCCGGGGCAACGCTGCCGACGTCCGATGTCGGGCCCGGTGCCGTCAACCTGGCCTCGGGCGGT
GCCGAGGGCCTCGTGCAGCTCTGGTCGCTCGAACAGGACACCCCGGTCGCCACGCTGGCTGGCCATACAGCACGCGTCTG
TCGCGTCGAGTTCCACCCGTCGGGCGCTTTCCTGGCCTCGGCCTCCGAGGATGCCTCGTGGCGGCTGTGGGACGTGCGGC
GAGCGGGCGAGGACGCCTCGTCGGCTGAACTCCTTCGTCAAGAAGGCCACTCTCGCGGCGTCTATGCCGTCAGCTTCAAC
ACTGACGGCTCGCTCATCGCCAGCGCCGGCCTCGACAGCATCGGACGCATCTGGGACCTGCGGTCCGGCCGCACAGTCAT
GATCCTTGACGGCCCGCTCGACGGCCACATCAAGCCCATCTACGCGCTCGATTGGGGCGCCGACGGCCACCGCCTCCTCT
CCGCCTCGGCCGACGGCTGGGTCAAGTGCTGGGACGTCCGCAAGGTCCAGCGTGCCGGCGGCATCGGCGCCCACACCAGC
TCCGTCTCCGATGTCCGCTGGTTCAAGGGCCTTGACGACGGCCTGCTCGGCACGCCGCCTGGCCCCGACGACAAGGGCTT
GCCGCAGCCCAAAACATCCGGCACCTTTTTCGTCTCCAGCGGCTTCGACCAGAAGATCAACATCTACTCGGCCGACGACT
GGGTCCTCGTCCAGTCGCTCACCGGTCACACCGGCCCCGTCGCCAGCGTCGACGTCAGCCGCAATGGTCGCTGGATCGTC
AGCGGCGGCCACGACAAGACTGTCAAGCTCTGGGGTCGCGACGATGGATCGGACATGTACTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62