GenePrediction:GLEAN_7250 Details

Name: GLEAN_7250
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3195981..3194592 (- strand)
Length: 1390
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3195981..3195244 (- strand)
Length: 738
Type: CDS
Source: GLEAN
Position: GCSC_140:3195167..3194592 (- strand)
Length: 576
>GLEAN_7250 class=GenePrediction position=GCSC_140:3195981..3194592 (- strand)
ATGTCGTCATCGATCTCGTTCCCGACCGGCGTGACGAAGCGCGGCTTCAACACGTACAGCCTGCCGGCCCCGGGGGCACC
CTACTACACGCCGGCCCAGACACCGCCGACAGGCACGGCAGAGACAGCCGAAGACGGCGAGACCAAGCCGGTGCCGACGC
TGTTCACGCCGCTGACGATCCGCGGCGTGACCCTGGCGAACCGGATCACGGTGTCACCCATGTGCATGTACTCGGCCGAC
GACGGACACGCGACCGACTTCCACCTCGTGCACCTGGGCCAGTTCGCGCTGCGCGGCGCCGGCCTGACGTTTGTGGAGGC
CACGTCGGTGCAGCCCAACGGGCGGATCTCGCCCGAGGACATGGGGCTGTGGGCCGACAGCCAGGTGGCGCCGCTGCGGC
GCATCGTCGATTTTGTGCACGCGCAGGGCCAGAAGATCGGCGTGCAGCTGGCTCACGCGGGCCGCAAGGCGAGCATGATG
GCGCCGTTTGCAGCGAAGCACCGCACGGTGGCGCAGACAGCCGGTGGCGGCTGGCCCGACAACCTCGTGGGCCCGTCGGC
GCTGGCGTACGACGTGAGCACGCCGACGCCGGCGGCCCTCTCGCTGGCCGCCATCCGCGACATGGTCGAGGCGTTTGCGG
CAGCCGCACGGCGGGCCATGGAGGCCGGCTTCGACGTGGTGGAGATCCACGGCGCGCACGGCTACCTGCTGAACCAGTTC
CTGTCGCCGCAGTCGAATGTGAGTTGCAAGACACAAAGAAACCTGATGTCGATCTCGGTCTTAGACAACCAACTAACCCC
CCTCCCCACCCCAGAAACGCACGGACGAGTACGGCGGCAGCTTCGAGAACCGCACGCGGCTGCTGTTCGCCGTGATTGCG
GCCGTCCGTGCCGTGGTCCCGTCGACGACGCCCGTCTTTGTGCGCGTCTCGGCGACTGAGTGGCTCGAGAAGGTGACGAA
CGAGCCGTCGTGGACGGTCGAGGACACGATCCGGCTGGCGCAGCTTCTGCCGGCCGCCGGTGTCGACCTGATGGACGTCA
GCAGCGGCGGCAACAGCCCGCACCAGAAGATCGACGTGCACCCGCACTTCCAGACCGACATTGCGGCGCACATCCGCAAG
GAGCTGGACGCCGACGCTGGTGCCAACACGGGCAGCAAGAAACTGCTGCTCGGCACTGTCGGACTGATCACCACGCCGGA
GCTCGCCCGCGACGCCGTGCAGAAGGGCGGCGTGCCTGGTGGCCGTGTCGTCGAAGCCGACCTGGCTCTCGTTGGGCGTC
AGTTCCTGCGCCAGCCTGACTTCGTTCTTTGGGCGGCCCATCAGCTCGACGTCGACGTCAAGTGGCCGCTGCAGTATTCG
CGGGCGCACTGGAAGCAACAGCCGCTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62