GenePrediction:GLEAN_7251 Details

Name: GLEAN_7251
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3185050..3183408 (- strand)
Length: 1643
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3185050..3185011 (- strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_140:3184948..3184842 (- strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_140:3184786..3184597 (- strand)
Length: 190
Type: CDS
Source: GLEAN
Position: GCSC_140:3184534..3184500 (- strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_140:3184403..3183408 (- strand)
Length: 996
>GLEAN_7251 class=GenePrediction position=GCSC_140:3185050..3183408 (- strand)
ATGGCACCCAAAAACCGCATCATCATTGACACTGATCCCGGTGAGAACCCGCACCCGGACTTCGGTCCCCGCTTATCGTC
GTGTCACGTGCTGACTACGCAGGTGTCGACGATGTTCTCGCCATGCTGCTGGCCCTCAGCGCCTCGCCTGAGGAGCTAGA
GGTGGTGATGCTGTCGGTGACTTATGGCAATGTCCCGCTGCAGAGGCACGTATCTCATCTGGCCATCCTGCTTTCTCGCG
TCCTCTCCGTGCACTGCTGACCAGAAGGACGGCCGCAGCTGTCTGCGCAATGTCGTGGCGCTCTTCCATGTCTTGGAGAA
GGAGCTGGCATGGCGCAGCTCGACTGGCCGGGCTTCCGGTCCGGGTTTTGGAGCGCTTAAAACGTACAAGCCCATTGTCG
CCTTAGGCGCCGAGCACCCGCTGGAGGACGAGCTGCTGATGGCCGACCATTTTCGTATGTCTGCCGCCGAGTCACCAGTC
TGGTTTGCATCGTGTTGACTGACGGGACTTGTCCAGACGGTGCCGATGGTCTGCATGGCGTGCACGAGGCTGTAAGTCTG
CTCGGCCTCTTCTCGGCCTCTGCCATTTCGGCATCGTTGACGTCATCACGCTGAGACATGTTTGCCTTTGTTTGTCTCTT
GATTTAGCACCCCGATCTCAGCCCTGCGGACACGTGGAAACAGCTCTTTGCCGAGGAGAGCCAGCACGCCAGCGCGGCCG
CGCCTCCGGCCGACACGGCCTCGCTCTCGGCCTTCTTCACGCCGTGCAAGACGGTGGCCCACAAGGAGATGTTGCGCATC
CTTCGAGAGGAGCCGGCCGACACGATCACGATTGTGGCGATCGGGCCGCTGACCAACGTGGCACTGGCTGCAGCTGAGGA
CCCAGTGGCGTTTCTGCGGGTCAAGGAGCTCGTCGTCATGGGCGGCGCCGTTGATTTTCCGGGCAATATCACGCCGTCGG
CCGAGTTCAACTGTTATGCCGACGCGGTGGCGGCTGCTCGCGTCTACGCGCTGACGTCACCAACGCCGGCCTCAACCATG
CCGCCGCTGCTGCACGGCAAGTCCGTGCTGCCGCCGTATCCGGCCAGCCTGCCGCGGCAGTTGAAGCTGACGCTGTTCCC
GCTCGACATTACGACACCGCACCTGCTCGACGAACCCTTTTTCCACGCGCAGATCGCGGCGACCGAGCAGGCCGACAGTC
CGCTCGCCCGCTGGGTCCGTTCGTTTATGGACGGTACCTTCCGCAAGATCGCGTCCATCGAGGGCGAAGGCGGCGAGCTC
GGCCTCTCGCTCCACGACCCCATGTGCATCTGGTACATGCTGCAGCGCGACGACCCGGCTTGGAAGCCCGTGGCTAGGCC
CGAGGACATCCGCGTCGAGACCGTTGGCCAGTGGACTCGTGGCCTGCACGTTGTCGACCGCCGTGGCCGGGACCGGCCCG
ACGACAAAAACACCAACGTCGCCGCAGCCGCCATCACGGCCGAGACTGTCCCCGGTGGCGACGACTTGCAGATCGGCGAG
GTTCCTGGCGACGACATGGGCTGGATGAGCACCAGAAGAGGCAACCGTATCAACCGTATTATCGGCTCGCCAGGCGTCGA
CGTCTTTGCAGGGTACCTGATGAAGAGGATTTTTGAATGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62