GenePrediction:GLEAN_7252 Details

Name: GLEAN_7252
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3179793..3178641 (- strand)
Length: 1153
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3179793..3179688 (- strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_140:3179620..3179020 (- strand)
Length: 601
Type: CDS
Source: GLEAN
Position: GCSC_140:3178959..3178641 (- strand)
Length: 319
>GLEAN_7252 class=GenePrediction position=GCSC_140:3179793..3178641 (- strand)
ATGGCCCAGAAGTGTGTGCACCAGGGATGTGGCAAGACGTACACGGACGCAGACGAGGTTTGCAGGTACCATCCCGGTCC
GCCTGTCTTCCACGAAGGCCAAAAAGGTAAGCAGACACGGCAGGCCAGCGGCCATTCGATCCGCTTCTTTGCTCATACGT
GCCCCTGCTGCAGGATGGTCGTGCTGCAAGCCGCGCGTGCTCACGTTTGAGGAGTTTATGGACATCACGCCTTGTGCGGA
GGGTAAGCACAGTACGACAGACCTGCCGCCCAAGGTCGAGAAGAAGAAGGAGTCGCCCGAAGCAGTTGCAGCAGCGGCTG
CAGCAGCGGCTGCCGTCGATGCCCAGTTCGGACCAGCCGTGCCTCGGAACCCAATCAACGTGCCGGTGCGCGAGAAGGCA
GCAGCACCAGCAGCAGCAGGCACAGCGACGTCGGGCGCTCCATCAGCACCGGACACACCCGTGGCGCCGCCCGAATCCGA
GGACGATGAGCCCAGCCTGGAGATTCCGGTCGGACGAGTGTGCCGGCGGCGGGGCTGCGGAGTGGCATACGCCAAGGGCG
GGTCGCGCGAGGCCGAGTCGTGCGTGCACCACCCGGGAGCGCCGATCTTTCACGAGGGCAGCAAGGGATACACGTGCTGC
AAGCGGCGGGTGCTTGAATTTGACCAGTTCATGAAGATTGAGGGCTGCCAGACCAAGGGCCGGCACCTGTTTGTCGGGAG
TGGCCGCAAGGACAAGGGCTCGGGAGCAGGAGAAGAGCTGCTGGAGACAGTGAGGTGAGTTGGGGGGCAGAAGGAGAAAA
AGAGAGAGGCACACACACAATGCTAACCTTGCAGGACGGACTTTTACCAATCGTCCACGGTCCTGACGGTGTCCTTCTTC
CTCAAGAAGATCGACAAGGACAAGGCCGTGATCCGATTCCTGGAGGAGGCCATCGACCTCGACCTGCCGACCACAGACAG
CCCGGTCAAGCGATACAAGACGGTAGTGCCGCTGTATGCGGCCATTGACCCGGCGCGTTCGTCGTTCAAGGTGCTGGGCA
CGAAGCTGGAGGTGGTGCTGGCCAAGGCCGACGTGAGCTCGTGGCCGGTGCTGCGCAGCGACGACCGGCTGACCGGCGAG
ATCATCCAGACTGGACGGGCCGCGAGGGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62