GenePrediction:GLEAN_7253 Details

Name: GLEAN_7253
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3177019..3174842 (- strand)
Length: 2178
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3177019..3177011 (- strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_140:3176443..3176134 (- strand)
Length: 310
Type: CDS
Source: GLEAN
Position: GCSC_140:3176061..3175581 (- strand)
Length: 481
Type: CDS
Source: GLEAN
Position: GCSC_140:3175235..3174842 (- strand)
Length: 394
>GLEAN_7253 class=GenePrediction position=GCSC_140:3177019..3174842 (- strand)
ATGCCTTGCGTAGGATCCACTTCTCCTCGATTGCTCCTGCCTGTCGTCTGTCTTGTCCTGTCTGTCCGTTGAGCGCTAAG
ACGACGGGCTGTCACCTTCGTTTTTTTCCTATCCCACCATCTCATCGACAGCATCATCCATCTTCTTTCTTGTTGCTCCC
TCTCCTTTTCGGCCGCTCTCCCTTTGTCTCGGCACCGCCCTGCTGTCTGCCGCCGTCTGTCTTTTGTGATCCGCCATCGC
CGCTTTTGGCTTCTCCTTTTTTCCCAATATTTTTTGGTTGCTTGCAGCTTTTCAGTTTCAATTTCGGTTGTTCGCTGGCG
ATACGACGTTCTCTTTAACCTGACCAGTGTCCAAGTCTTGGCACATCTCTCTCACCATCGTCGTCATGCCGCCGCCTCCA
CCGCCTCCACCTCCACCGCCGCCGGGCGGAGGCATACCACCACCGCCTCCGCCTCCGCCGCCGGGTGGCTTGCCGAAAGC
GCCTCCTGCTAGGGTGAGTTGAGTTTGAGTTGGACGAGAGCAGCCGCTTTGGCAGTCTGCAGAAATGCTGACACCCTTCC
TTTTACCCTCGCCCAGAATGCGCTTCTCGGTGACATCCACAAAGGCAGAGCCCTCAAGAAAACCGTGACCAACGACCGGT
CTGCGCCCATCGTCGGCAAGGTCTCTGGAGGCGCTGGTCCTTCACCTTTGGGCGGTGGCGCTCCAGCTGTTCCTCGGCCT
CCTGGCCCCAGCAGCAACGGCCTGAACCCTCCGTCTATGGCCAGCCGGGCCCGCAGCAACAGCGAGCATGTAGGCGGCGC
CGACATGAGCGCGCCGCAGCTCGGTGGCCTCTTTGCCGGCGGCATGCCAAAGCTGCGAAAGACTGGAGGAGGTGTCAAGA
CTGGAGGTATTTATTTCTTTCTACCTTTCTTTTACTTTTCCTCTGCTCTCCGTCTCTGCTACCTTCTGACCCGTGCAGCC
GTGTCCCATCTATCCGATTCCGAAGACAACTCGCGAAAGAGTGCTCCTCGACCACCGACCTTCTCGGCCCCAAAACCACC
TGCCAGCGCCGCTCCTCCGATTCCTGGCCGGCCTTCTTTTCCCGCCCCGAGTATACCTCCTCCACCACCAGTCTCGGCAC
CGCCCACACCAGCTCCGGCTCCTCATCCTCATTCCCATTCTCAGCCTCATCATAGCGGTCCAACATTCCACCCGTCCATT
GTGAACCTGCGCAAACCCTCTGGCCGAACCGACATGTTGCGACCAAACTCTTCGGCTTCTCAGATCGTCCTCAACAAGGG
TCCTCCTCCTCCCATCGGCAAGAAGCCACCACCTCCACCCGGCTCTAGGAAGCCCTCGTCGTCTGTGTCCACGCCTCCTG
TCCTGCCACCATCTCATCCGCCGCCACTTCCCTCGTCGGCAGCTCCTGCCATCCCGTCGGCACCTGCTCCGCCTGTGCCG
TTCGCTCCGTCAGCCCCGGCACCCATGATTCCCTCGGCTTCTTCGGCTCCGCCTGCACCTCCTCCGCCTCCTCCGCCTCC
ATCAGCGCCTGGCAGCTTTCCGCCCTCTCGCTCTCAGCCACAGGCTCCTCCGCCTGCTCCTCCACCGCCTCCACCGCCGC
CTTCTTCCGCTCCGAGCATGTTCAGCCAGAGCCTTGTCGCCCAGGTCGCCAAACGCGCTTCTTCCAACTCCCCTTCTTCA
TCACCTTCCGCACCACCACCACCACCGCCGCCGCCGCCACCGTCGGCACCCGCGCCGTCGCCGTCGTCCGCGCCTCCACC
ACCGCCTCCGCCACCTCCCAGCAGCCAGGCACCCACGACGACATCATCTCTGCTTCCGCCGGCTCCGTCCACTTCGACGT
CCGTCTCCCTCTCTCCGCTGATCAGCAGCAAAACTGCCAACCACCTCGCGGCCGTGCCGCCGCCAATGCGCGTGTCTATG
CTGGACCCGTCTGCCTACACGCTGTCGTCCAACGGAAGCAGCGGCGCGCCCGGTCCATCGCCAACGCGTAACGGCGGTGG
CACCGTGTCGCCACGGGCACAATCCAGTGGAACGGGGCGCTACATTGTGCAGGATACCCGGTGGCGCTTTATAAGCGACG
ACCAGCTGCCCAAGGCACGTGAGTTTCAGGCCGGCATCAAGCGCTATCGGGCCGGACGGGGTAGCAGTGTACCGCTCGAC
TTGAGCTCGCTGACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62