GenePrediction:GLEAN_7254 Details

Name: GLEAN_7254
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3167783..3167387 (- strand)
Length: 397
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3167783..3167558 (- strand)
Length: 226
Type: CDS
Source: GLEAN
Position: GCSC_140:3167478..3167387 (- strand)
Length: 92
>GLEAN_7254 class=GenePrediction position=GCSC_140:3167783..3167387 (- strand)
ATGCCGACTCCCGAATCGGCCGCCTTCTTGGCTCGGAAGCCGACCGTCCCGCCCACCTTTGACGGCGTTGACTACGATGA
CTCGAAGCGCTTGAAGCAGGCCCAAGATGCCATTATTCGCGAGCAATGGGTGCAGGTCATGATGGGCCGGCTGGTGCGGG
AAGAGCTGGGCAAATGCTACTACCGGGAGGGTGTCAACCACCTGGAGAAGTGCGGCCACTTGCGCGGTAGGTGGAATCTC
GAAGGACTGCCGCACGCGAGCCGTTCTCGACAAAGGGGCAATGCTCCGGCTAACTTTTGCTGCAGAGCGGTACCTCCAGC
TGCTCAAGACGGCAAGAGTCAAGGGCTACTTGTTCGACCAGCAAAACTATATCTCGAAGCAGGAGGCCCAGCAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62