GenePrediction:GLEAN_7256 Details

Name: GLEAN_7256
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3163063..3162310 (- strand)
Length: 754
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3163063..3162667 (- strand)
Length: 397
Type: CDS
Source: GLEAN
Position: GCSC_140:3162605..3162310 (- strand)
Length: 296
>GLEAN_7256 class=GenePrediction position=GCSC_140:3163063..3162310 (- strand)
ATGGCGCCGCCTCCTCCGCTCTTCCACAGCCTGCTGCGGCCGTGCGTGCTGCAAATCCTCCGGGCGCAGGGCTACTACGC
AGCGCGAACGTCAGTCGTCGACAGCCTGACAGACATGGCAGCGCGGTACCTCACGGCGCTGTGCGAGGCCACGGCGCGAA
ACGCGGCGCACAACAGCACAGAGCTCACGGGGCTGGTGCCGACGATCGTAGACGTGCGCATGGCGCTGGAGGACTGTGGC
GCTCTGGCACCGCCGTCCGCCTTTGAGGGTCCGGACTGGCCGGGAGACGACACGCGCAGTGCAGACGAGTTCATCGACTG
GGTGTGTGGGCCGCGGAACCGGGAGATCAAGCGGGTGGCTCTGGACGGTGACGATGAAAACACGGATTATTTGAGTGGTG
GGTGTCCTTTGCTCTGTTCGCTCTTCATCTTCCCCGCCCAAGTCAGCTAACAAAGCAGTCCTGAAGAAGAAGCACAGTAA
GACGGGCGAAGACTCCAAGTACAGCGGCACGGTCCTGGGGCGCGGTAACGAGCACGGCGACGTGGTGGTTGAGGGCGGCG
AGTTCCCCAGCATACTGTCGTGGCAGGAGAAGCGTATACAAGAGCGACAGCGGCCACCTGCAACGCCGGCGCCAGGCGAG
GAAGGAGCAGAGGGAGAGGGCGGCCAAGGAAGAAGTCCGAGCTCAGGACTCAGTTCGGTTGGCGACCGGTCAATGGAGGA
TATGGAGCTCGAGTTCTCTGTGCCACCATCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62