GenePrediction:GLEAN_7257 Details

Name: GLEAN_7257
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3158803..3156893 (- strand)
Length: 1911
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3158803..3157807 (- strand)
Length: 997
Type: CDS
Source: GLEAN
Position: GCSC_140:3157740..3156893 (- strand)
Length: 848
>GLEAN_7257 class=GenePrediction position=GCSC_140:3158803..3156893 (- strand)
ATGCCGTCGCCGAAGCGAGTGTCGACTTGGCGCCCAGCTGTTGCGGCTCTTCCGGCTTCGATTCCGAGCGTGTCTGTGAC
ACCTTCGCCCGACACGCTCGTGCGGCCGTCAGCGGACATTGAGATGGGTTCTGTCGTGCCGCCCGGCCACCGGCGGCGTA
GGAGCAGCGCAGCCAACGGGGCGGCCAGCCAGGTCAGCGTCAGCCATCTGGGCCACCTCAATGGAGAACGAGGAACTCGT
CCTCGGGGCGAGTCGCTTCCGGGAGGCAGCAGCATCATAGCTGTGCCTGAGCACGCGCCAGGGGGCAGCAGCGGCACCGG
TGACGACGACAACGACGACAGTACGTGGGACGACGCGTGGGACGATGGCTTTGATGACCTCGACGAGGAGGCCGGGCTGA
CGGCGCCGGAACGCCGCCGCCGAGCAGAAGTGCGACGGCAACGAACACAGCTGGATCAGCGCGTCGTTCCCGGTGCCAGC
ATCGAGGCCGGTCACATCGTCGATGACGGCAACGGACCGGCTGTGCCCATCAGCGAGGACGAGCGCAAGCTGGCCGACAA
GGCCGTGGTGCGGCGCCTGGTGATCGACGGTACCCTGATCGGTCTCTGGTACCTCTTTTCGCTGAGCATCTCGCTCTACA
ACAAGTGGATGTTTGGCGGCCAGAACCTCAACTTCCCCTTTCCCCTTTTCACTACCTGTATCCACATGCTGGTGCAGTTC
ACCCTCTCCAGCACGGTGCTCTATTTTGTACCCTCTCTGCGGCCAGGTGCCGGAAGCAGCAGCAACAACAGCAGCAGCAG
CAACAACGATGGCAGCTACAATGACGACGACGATGAAGACGACGACGTGTACAAGCCGCAGCATGAGGCTGAACCGCGGC
CGACCCTTATGACCAAGATGTTCTACCTGACGCGCATCGGTCCTTGTGGTGCGGCTACTGGTCTGGACATTGGTCTGGGC
AACACGTCGCTCAAGTTTATCACCTTGACATTTTACAGTGAGTGAGAAGAGGAAAGAGGAAAGAAGAAGGACAGGTTGAA
CCAAGACGCTGATCATCCTACAGCCATGTGCAAGTCGTCTTCGCTGGCCTTTGTGCTGCTCTTCGCCTTTGCCTTCCGGC
TCGAGACGCCAACTCTGCGGCTTGTGGCCATCATTGCCACCATGACGGCCGGCGTGGTCATGATGGTGGCCGGCGAGGTT
GAGTTCAAGCTGGGCGGTTTTCTGCTCGTCATCAGTGCCGCCTTCTTCTCCGGTTTCCGCTGGGCTCTGACCCAGATCAT
GCTGCTTCGCCACCCGGCCACATCCAACCCTTTCTCGAGCATCTTCTACCTGGCCCCCGTCATGTTCGCCACCCTCTTTG
TCCTGGCCGTTCCGACCGAAGGCCTGGGTGCCCTCTCTGCCGGCTTCGGCACTCTCGTCGACAAGTTCGGCCCCCTGCGC
GCCCCCGCTCTGGTCCTCTTCCCCGGCACCATTGCTTTTCTGATGACCGCCTCCGAGTTCGCCCTGCTGCAGCGCACGTC
CGTCGTCACCCTCTCTATTGCTGGCATCTTCAAGGAGGTCGTTACTATCGCCACCTCCACTCTCGTCTACCACGACACTC
TGACGACCGTCAACATCCTCGGCCTCGTCGTCACCATGACCGCCATCATCGCCTACAACTACATCAACATCACAAAGATG
CGCCAGCAGGCCCAGCAGCACGTCCACCAGGAGCGCCGGCGCTCCTCCTCTTTCGGCTCCGACTCCTCCTCTGTCCACTA
CTATCCCTCCCTCGCCCCGGTATCGTCCTCGTCGCCGGCCATGGCAGCCACTGGCGACGACAGCGACGTCGAGGTTGAGG
CTGAGGCCGAGAACGCGGGTCTGCTTCGCAAACACACCCCCAGTCGCCAGGCCGGAGAGCTTCTAAGATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62