GenePrediction:GLEAN_7258 Details

Name: GLEAN_7258
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3153766..3151537 (- strand)
Length: 2230
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3153766..3153753 (- strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_140:3153215..3153183 (- strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_140:3153110..3152555 (- strand)
Length: 556
Type: CDS
Source: GLEAN
Position: GCSC_140:3152489..3152055 (- strand)
Length: 435
Type: CDS
Source: GLEAN
Position: GCSC_140:3151977..3151537 (- strand)
Length: 441
>GLEAN_7258 class=GenePrediction position=GCSC_140:3153766..3151537 (- strand)
ATGTCTGGCCCCGTGTAAGTTAAGCGTGTCTTTCCTTACGCTACCGTTTGTCGCCGGCATCGTCGCGACTACGCCGCTCT
CAGCCGTTGCCGTGCTGGAGCAGAGCTGCTTCTGCTGCAGCAAAACTACCCCACCCCCGCTCAAACCTCAGGATGGCTGG
AGGTGTCAGTGAGACATCGCGACAAGCCAAAAGGGCCGTGGACAGATGCAACGGCAGCAAAGCATTTCGTAAAAGAGCCA
TTTCGTCACCCATCCATTCCCTTCCTTTTTGGGCTATTGGTCTGAAGCGCTCATCTACATGCCCAATGGCTAAACAATGA
CGACGCAGAACCCGCCTAGCTATGCTCGGCGGGGTGTTCGGCACCCCCTCCACCTCCACCTCTCCCCTGTACTGTCAATG
TCCACTCCATCAGCTACCCCTTCTACTTCTCTGTCCTTCACCCGCTCTGTCGTACATGCACTTGGCTTCCCCCTCTCTGT
ATCCCTCCGTCTTCTTTAACGTGAAATATACTGCGAAGTTTGAAGTATGGCAATGCTAACTGTCTTGGAAGCGCTGATCT
CGGCCTCATTGGCCTGGCCGTCATGTAAGTCCAATTCTGAAGCTTCCTAGCCACAGTTCCATCACCTTGACTAAGCTAAC
ATGTCTTGCTTGACAGGGGCCAAAACCTGATCCTTAACATGGCCGACCACGGCTTCACCATCTGCGCCTTTAACCGCACC
GTGTCCAAGGTCGACAAGTTCCTGGCCAACGAAGCCAAGGGCAAGTCCATTGTCGGTGCCCACACCACCGAGGAGTTCGT
GTCCAAGCTCAAGACCCCCCGTCGGGTCATGCTCCTGGTCCAGGCTGGCCAGGCTGTCGACGACTGGATCGAGACCCTTC
TTCCTCTTCTTGAGAAGGGCGACATCATCATTGACGGTGGCAACTCCCACTTCCCCGATTCCAACCGGAGATGCAAATAC
CTGGCTACCAAGGGCCTTAGCTTTGTCGGCTCTGGCGTTTCCGGTGGTGAGGAGGGTGCCCGCTACGGCCCCTCCCTGAT
GCCCGGTGGTGATGAGAAGGCATGGCCTCACATCAAGGACATTTTCCAGAGCGTCTCCGCCAAGAGCGACGGCGAGGCCT
GCTGTGACTGGGTCGGTGACGAGGGTGCTGGCCACTACGTCAAGATGGTCCACAACGGTATCGAGTACGGCGACATGCAG
CTGATCTCCGAGGTTCGCATCTGATTGCCACCCACTTTCCTCCTGCTTGGATTACCGTGCTGACCCTTACAATGCAGGCT
TACGACATCATGAAGCGTGGTCTGGGAATGACCAACAAGGAGATTGGTGACGCACTGGCCAAGTGGAACAAGGGCGTCTT
GGACTCTTTCCTCATTGAGATCACCCGTGACATTATGTACTACAACGACGAGGATGGCACCGCCCTGGTGGAGAAGATTC
TCGACAAGGCTGGCCAGAAGGGCACTGGCAAGTGGACTGCCATCAACGCCCTGGACCTGGGCATGCCCGTCACGCTGATC
GCCGAGGCTGTGCTGGCTCGCTGCCTGTCAAGCATCAAGGACGAGCGCGTTAAGGCCTCGACCAAGCTTCAGTTCGTCGG
CCGCGCCAGCACCTTTGAAGGCAACAAGGAGCAGTTCCTTGAGGACCTGGAGCAGGCCCTGTATGCCTCCAAGATTATCT
CCTACGCCCAGGGTTTCATGCTGATGCAGGAGGTGTGTATTGATCACCCGCTCGGATGACGTCTATTTGTTTCACCACGA
CAACCTTCATACTAACTTTCTTTTTCCAGGCCGCCAAGGAGTACGGCTGGAAGCTGAACAAGCCGTCCATCGCCCTGATG
TGGCGCGGTGGCTGCATCATCCGCTCTGTCTTCCTCAAGGACATTACTGCTGCGTACCGCAAGGACAATGACCTGGAGAA
CCTGCTGTTCGATGACTTCTTCAACAAGGCCATCCACAAGGCTCAGCCCGGCTGGCGTGATGTCGTTTCCAAGGCCGCTC
TTCTCGGTATCCCGACCCCGGCCTTCAGCACTGCTCTGTCGTGGTTCGACGGCTACCGCACCAAGGACCTGCCCGCCAAC
CTGCTGCAGGCCCAGCGCGACTACTTCGGTGCCCACACGTTCCGTATCAAGCCGGAGTTCGAGAGCGCCAAGTACCCCAT
CGGCCAGGACATCCACGTCAACTGGACCGGCCGCGGTGGCAACGTGTCTGCCTCTACCTACCAGGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62