GenePrediction:GLEAN_7259 Details

Name: GLEAN_7259
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3148146..3147364 (- strand)
Length: 783
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3148146..3147898 (- strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_140:3147625..3147456 (- strand)
Length: 170
Type: CDS
Source: GLEAN
Position: GCSC_140:3147379..3147364 (- strand)
Length: 16
>GLEAN_7259 class=GenePrediction position=GCSC_140:3148146..3147364 (- strand)
ATGTTCTTCCTACACAATCTCGAGCGTAGGGTGACTCTGCATCCGTCCTACTTTGGGCGGAACATGCACGAGCTGGTCAC
GACGAAGCTCCTGAAGGATGTCGAGGGCACCTGTGCCGGCAACTACTACATAATATCCATCATGGATACGTTTGACATCT
CGGCCGGCAAGATCCTGCCAGGCAACGGGCTCGCTGAATTCACCGTGGGCTACCGTGCCGTCGTATGGCGGCCATTCAAG
GGCGAGACGGTATGCGCAGCCAGTCCTGGCCCCGGTCTCGAGCACAGCTGCTTCTGCGTGTGAGAGGGGCGTACAGAAAC
GAGTTCAGAAACAGGCTGACACAGGAAAAAACATCAAGGTTGATGCCGTCGTCTACTCAGTCAATCCCCACGGATTCTTC
GCACAGGCTGGCCCTCTGCGCTTGTTTGTGTCGTCTCATGTATGGAAATTTCCTGCTTCGGCCGTTTCCGAGCATTGAAC
GACAGCAATGACGGTGGAGTGTGTTAACACTTCATGGACAGATGATTCCTAGTCAGGTCAAGTACGATCCAAACGCCACT
CCGCCCCAGTTCACGGACAACGAGGACTACCGGATCGAGCCCGGAACACATATCCGGGTCAAGATCATGGGCACACGAAG
CGAAGTCGGTGAGATGTGGGCAATTGGCACCATCAACGAAGACTATCTCGGGTATGCATATCTTTGTCCACACTGTGGCT
TCTCTCCGCTGGGAGAAATGAAACCAAAGTTAACGCCTCTCCCCTAGCCCTCTTGGCCCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62