GenePrediction:GLEAN_725 Details

Name: GLEAN_725
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1658076..1660496 (+ strand)
Length: 2421
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1658076..1658882 (+ strand)
Length: 807
Type: CDS
Source: GLEAN
Position: GCSC_97:1658952..1660292 (+ strand)
Length: 1341
Type: CDS
Source: GLEAN
Position: GCSC_97:1660365..1660496 (+ strand)
Length: 132
>GLEAN_725 class=GenePrediction position=GCSC_97:1658076..1660496 (+ strand)
ATGGCTGCTATTTCCACGTCTTCTCGTCCTGCATCAATATCCCAGCCGCTCTCTACGGTCACGACCTCGGCTTCTAGCAC
CTTTGCGAGCAATCGAGAGGGTCGAAGGGACCACTTGAACCCCAACTTTCGCTATTCCACCGCCACGCTTTCCCCTCCCC
AACTGCAGCAGCTTGCTTCCTCCACCGCGTCTTCTTCCACCTCTCAGCCGCCGGTCGGTCTCTCTGCGTCCGTTCCGCCT
CTGCCTGCTCTTGTCGGCTTTCCCAGTCCCAGTCCCCGTGGCCATCTGAGCACGCAATCGACGAGTTCCCTGTCTGCGCC
TACGTCGGCGAACAGAGGCTCAAGATCCAGCTCTCTATTGGCCTTGGCTGCCGCCGCAATCGATCGCACTCAGAGTGCCC
TTGCCAGTGCTGAACAGAAAATTCGCCCTCGGCAGTCGCTCAGTCGCCTTTCCCTCAGCGGCGACGCCCTCTCCCTGTCT
CTTCCACCTCCGCCTTCGTTCGGGACCTATCCGCTGGACCGCACATCGTCCAACTTTTCCAGCCCGGCCTCGCCTCTGGG
CAGCCCTTCGTTGGAATTTCTGCTGAGCCCCGGCCATCCGTTCGCTGACAAGACTGCTGTCGCTTACAAAGAGCCGACTT
TCACGCAGGCCCAGCCAGCTCAACAGGCCTACTCCTACTCCCAGCCGTATTCTCAGACTAACCCAAACCTCCCTCCTCCC
ATTCGCATGCCGCGTAGCGACAGCAAGATGCATCAAACGTCATCCCGTCTCCTACGGATGACCGACGACGATCGGCCGTT
CACAAGGGTGAGGACCTCCGTGTGCCTCTGAGCGTGTGGTGTATGATGCGTTTTGCTAACAGTATTCGCCCCCAAGGATT
TTAAAGATCTCTTCTCTACCCTGATTGTCAGCCTCCTGCCGCTCTCAGCACACCGTGTTCGCCTGACCAAGGTCGAGCAC
ACATTTTTGTCAGAAGATGCAATCAACAACTTGGGCTCGCTCAAATTCTCCCAGTCCAATCGTATGCCCGACCCGAAAGA
CCCGTCGCGCATCGTGACGACAACAACGACGACGACATTTTCCATGGCACGGGACATGGCTCGTTCAATATGCCAGCGCT
TTCTCGACGCTCGCTTCATCGAGTCGGCCGACGGCAAGTACCAGCAGCTCTACACGATGAAGGGCTCCGTATGGCAGCTC
ACGCCCAAGGGCATCTGCATTCTGGACCGGTTCTGCTCCCGCAACGGCATCCAGCAAAAGCAGGTGACCGAGCTCGTCGG
CAATAGTGTGGCTCAGCTGGTCATCCTGGAGCGCGATTCGGCGACCGACAAGGTTGTCAGTGACCGCGGATCGATCGAGG
TTATCTTCCGGCGCTTTGTCGGCGTCAATGGCCTTAATGTCAAGTCCAGTCTGGGTGCTGCAGACGCTGACTCCCTGAGC
GACTACCGTGACGGCCTGACGGGAGTGAAGATGGCTAGCGAGCGGAGAGTGAATGGCAAGGTCTACAAGGACACGTTTAC
GGGCAAGGCTGGCAGCGACTGGCTGATGGACTGCTCGACGATGGTGGATCGACGAGAGGCGAACGAGACCGCGTCGCTGT
TTGTCGAGTTTGGACTGATCGAGGCGGTCGTGCCAGACCGGGTGTTTCAGGTTCAGCTACCGGGCGTGCATTTGTACCAA
CCAACCCGGGTGGCCATCTACCAACTGACTGCCAAGGGCAAGGACCTGATCAATGGTGTGTTACCACGTGGACGATCGTC
CGAGAGCGACGGTGGCTCGGCGCCACGAGGAGGAGGCGGCATTGCACGCGACTCCAACACGCAGCGGCTGGACAAGATCT
TGAGTGATGCCGCGCTGCGGCTGCTCTTCCGCGAAAACCTGCGCGAAACCCACTGCGAGGAGAACCTGTCGTTCTATCTC
GACGTCGACGACTTTGTGCGCAACTGCCGGCAGGCGATTCGCAACGCGCAAAAGAACCCGGGAAACTCGTCGATGGAAGG
AATCAAGGAGATTATGGCGCAGGCGTACGGCATCTACAACGCATTCTTGGCTCCGGGATCGCCGTGTGAGCTGAACATCG
ACCACCAGCTGCGCAGCAATCTGGCTTCGCGCATGACCAAGGCAGTAGGCCAGGACGGCGCAATGATCGACACGCTGCGC
GAAGTCACGGCGCTCTTTGAGGACGCCCAGAACGCCGTCTTCAAGCTGATGGCTAGTGTACGTGCCCTTGTTTGGGGGAT
TCCACCCCCTTTTGAGATTGACAGGGGCAAATGCTAACTTCTCGATCAGGACTCCGTGCCGAAATTCCTGCGCCACCCCA
AGCACGAGCAGACGCTGAGAAACTACGACTTCGATGCGATTGTGGTCGGCTCGACTCGCGTGCCAGAACGCAGCTTGAGC
CGGTCCAACCGCAACAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62