GenePrediction:GLEAN_7260 Details

Name: GLEAN_7260
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3143424..3141677 (- strand)
Length: 1748
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3143424..3143164 (- strand)
Length: 261
Type: CDS
Source: GLEAN
Position: GCSC_140:3143102..3142951 (- strand)
Length: 152
Type: CDS
Source: GLEAN
Position: GCSC_140:3142870..3142683 (- strand)
Length: 188
Type: CDS
Source: GLEAN
Position: GCSC_140:3142610..3142060 (- strand)
Length: 551
Type: CDS
Source: GLEAN
Position: GCSC_140:3141988..3141677 (- strand)
Length: 312
>GLEAN_7260 class=GenePrediction position=GCSC_140:3143424..3141677 (- strand)
ATGGGTTACTCCAAATTTGGAGTGTACTTCGGCTGTATCTCTACTGCCAATGCAGCCTGTCTCCGAGGCACTCGCGGGAT
TGCCACTTTGCCTCGCAGGGCCCAGACAGCCCTAAAGGAGAGGTCCATCGAGGAAATCCAGACCGAGGAGAGCCAGAAGA
ACATGGCAGCAGCACCAACAGCCCTGAATGATAGCTTCTGGCGAAAGATCACCGTCTGGGGGAACATATCCCAGGATCAG
TTTCTCTCCTACCGATGGAGCGTTAGTAACCCTACGAAAATTGAAAATACAAAAAAAGAAAAATGCTGATTTTGACGGAT
AGGTGGCGCAGACCGTCCAAGGAGAGAGAAAGCTCGCCAACTTCCTCGAGGCCGTGCTGCCTGACGCTGTACCTTACGAA
GAAACTGGTGACAAGATGCAGACACGCGAGGATCTCGTAGCCGATGTCATGGACGGCATCAAAGCGGCCACAATGTCGAC
CAGAATGACGTGCTGAGCCCCCAATCCCCACTCGCCTTTTCCTGTCTTTGACGACAATGGCTGACTTCGTATAGGCCATA
TGTGCTCAGCCGGATCAACTGGAAGGATCCTCGCAATGACCCTATCTTCCGCCAGTTTCTGCCGGTCAAATCGCGAATGA
TTCCTGATCACCCAAAGCTGACGCTCGACTCTCTGCACGAGTCTGCCGATTCTCCCGTCAGTGGTCTGGTGTACCGCTAT
CCGGAGAAGGCTCTTTTCTTGCGTAGGTTTATTGTCTGGAGTTTGCAATTGGTTGCTATCATTTACGTCCTTGGCTGATT
CTGGACCGTGATAGCCACATCAGTCTGTCCGACCTACTGCATGTTCTGCACGCGTTCATATGCCGTGGGCGGTAACACCG
AGTCGGTCAAGAAGGCATCGATGAAGCCGACCAAGCGTCGCTGGGAAGAGGTGTTTGCCTACATTGAAAGCCAGCCTGCT
CTGCAGGACATTGTCGTCTCTGGCGGTGACGCCTACTACCTGACTCCTGACCAGCTGGCGTATGTGGGCGAGCGTCTAAT
TGCCATGCCGAACATCCGTCGGTTCCGGTTTGCCTCCAAGGGCGTGGCCGTGGCGCCTGCTCGCATCCTCGATGCAGAGG
ACAGCTGGTTCGATGCACTCAGCTATGTCGCCACGCAAGCACGCAAGGCCGGCAAGGCGATGGCGCTGCACACGCACTTT
AATCACCCCAACGAGATCTCGTGGGTGACGGAACAGGCAGCACGCAAGCTTTCCGAGGCTGGGATAATGGTCCGCAACCA
GACGGTGCTGCTACGAGGTGTCAACGACGACGTTGCCACGATGTCGACGCTGATTCGCAAGTTGGCCGACAACATCATCT
TCCCCGTAGGAACTACAAATCTCCCTTCCCCCCCTTTCTGGATGTCCGAAATCATAGGCTTATTCGATTTCCACAGTACT
ATGTGTACCAATGTGACATGGTCGAGAAGGTAGAGCACCTCCGGACGCCGCTCCAGACCATCCTGGACATCGAGGCTCAG
ATCCGGGGCTCTATTGCTGGCTTCATGATGCCGCAGTTCGTCGTGGACCTGCCTGGCGGTGGTGGCAAGCGTCTGGCTTG
CTCGCACCTTGACTACGACCGCAACACTGGGGTCTCCCGGTTCATGGCGCCTGCAGTGACTGGCCGAGACAAGGACAACA
AGGTGTATGAGTATTACGATCCTGTGGATGCACTTCCTGTGCCATCTACCACTCCCACGAGCGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62