GenePrediction:GLEAN_7261 Details

Name: GLEAN_7261
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3138185..3134881 (- strand)
Length: 3305
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3138185..3138160 (- strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_140:3137894..3137378 (- strand)
Length: 517
Type: CDS
Source: GLEAN
Position: GCSC_140:3136395..3134881 (- strand)
Length: 1515
>GLEAN_7261 class=GenePrediction position=GCSC_140:3138185..3134881 (- strand)
ATGCTCTGGTTGTACCGTCTGAACCAGTGAGTGACCGTTGTCGGGAGGAACAGACGGGGTCAGCGGGAGGAATTGGACTT
CTCCCGCCTGGCTGCTGAGCCTGTTATTCTGTGCCATTGCCGTTTCTGCAGACATTCACGTTTCTGTTCTCGTCCTCTCT
GTTCGTCTGTCTTCCATTCTGCTCACCATCTCATCCTGCTGTCGACAGAACTGCCAGCTTGTCCCCTGAGTTCGACGTGA
AGGAGAGCTGCCAGAGAAAAGTCTCGCACCCACTTCACCGCCCACGTGCAGCTCCGAGCTCGCCCAACGACACCGTCCCG
ACACCGACACCGACACCACAGAACAGCACGGCCGACCGGCTGCAGACATGCCTTCTCAGACCGCTTTGGCAACGCCTGGC
GACGACAGCGGCATGGACAGCATGACAGTCGCCGCCGCATCGGCCAACGGCGCGTTCTACCACCACAACATTGCAGCGCA
ACAGCACGCCAACGCAATCCTCGGCACGGGCTTGTGGCGGCCAGAATCCGCCCCTTCGACCGGACGGAACATCTCGCCCA
GCCCGCTGCTCAGACGGCTGGCACGAGGTGCAGGACGGCGGCACCAGAGCGAGAGTCCATCGGGCAGACCAGCGAGAATA
TCGGATCGTCGTGCTGGCTCGTCCAGCAGCAGCGGCTACCGCAGCTACAGCGCTAACACCCACGACACGCGCTATGGCAG
CGCCAGAAGCGCATCGATTTCGTCGGGCGTGCCGCCACCGTTGTCCCGGGACGAGTTCGAGGCACTTCCCGTTGCTATAC
AGAGAAAGGTAAGATACTGTGCTAGCCAGCCTTTTCCCTTAGTTCCCTTCACTGCATGGAAAAAGAAAGCAGCGAAACCG
CGCCAGCGAGCAAAAGCAAGGAAGGCCAGAACAGGCAGCTCAGCAAGTGCGATACACTCACTGCAATGCATCCATTCGCC
ACTGGCCGTCTGGAGGCGCGCTCCCCTCCCTCAAATAGCACCACTCTCATTCTTGACGAGTAGCTGGTGGCTGGTGGCTC
CAGCGGCTACAGCCTAAAGTGGAAAAGCTGTGGGAGATCACCCCTTCTGTCCCTTGTCTAGCCTGCAGGCCAGGAAAGCG
ATTGGATCATTCGCAAGACGAGCTGGACGAGTTAGGCTTCGCGCTGCTGTTCCGAGTGGACGCCAGACTTTCGTCTGACT
CGGCTGCGCCTAGTATGTGCCAAGTGTGCTCTCGTCACAGCACACTGCGACGCCAGAAGAAGGCAGCGAGGCATCACAGA
CGTTGCAGTGTCACAAACTCGATCAAGCTGCATGCTCGGTCCCCATGCACCCCAAGCTTTTTTAGGGGCGGCTCTAAGCC
GTCTTTGAGCTGTCAAGGGCGCCTGTTCCCTGTCTTTTCTGCCTTTATCCCTTTCTGTTCACGGCCAGACGAGATCTGGA
CATTGGACCCGCAGCTGCATGCCTGCTACTCTGTATGCACGCACGAGTACTCCGTGCTGCAAGATGCTCTCGTGCAGTCT
GGTGGCGTTTCTCACACAGTCCATTTCACCTGCATTGGCTCCATAATAGTCTCCCTTGGTCGACCTTTTTTGCCCGTCTT
ATATTAAACCTGCCTCTCTCTCCCTGCGTCCCGCTTTCTGCTTTCATTGCCTGATGATCTTCGGCCAGCAGCCCTACCGT
GTTGCTCTGGCAGTTGCTTCTTTCTGTTTGCTTTTGGCCTGTCTGTCTGTTTTTGGAGATAACAAAATGCCTGGGTTCTA
ACGCATGCTTTCTCTTCTTGCCCTGTGCAGTACTTCTCTACGCTCGAACGACTTCGCTTCGCTCAGGACTCCGGTGTCGA
CGGGATCTGCCAGCACTACGACGACATCTCTGCACAGAATCTGAAGCGCCGGAAGTCGCGCCAGTATCCCAGCGGCTCAG
GGAATATCTCTGGCCGTCTCAGGCGACAATCGCTGCGGGAATCGCCTGTGACCGACTCGTTCATTTATGCCGCCCTGCCC
GACAAGCTCAGAAAGCGCGAGTTCAGCCGCGAGGAGCAGGTCATATTAGCAGGACAGCTCCGTGCCAGTGTCATCCTCGA
CGCCGCCGACGAGGCCGTGTACAGGATAGGACGGCGTGCCAGCACCCGGCAGCTCATTCCGGACATCCAGATTGACAGTC
CTTCACTGTCGACTCGGCGCAGCATGGAGTCTGTAGGCAACGGCAGCATTGGGCCGCTCGACCTGGCCGGCAACCGGGCC
AGTGCCGTGCCCGATTCATTTTACAACTCTTTCCGGTGGGTAGACGAGGACGAGGACCTGGATCTGCGTCTCTTCCTCGA
CGACTACCACGCCAATCTCCGCGAAGCACTGCCCCAGCATAACAAGGAGAGACATCCGTCGTTCCGGCGCCGCATGTCTG
TGTCCAAGATCCCCTTCAGCCTGCCGCTGGCCGAGCCAAGTCAGCCACCGGTGAAGGACACCCGGTCCACTGCGTCGGTG
TCGCCGAGCCCGAGTCAGAGCTCATCACCGTTTCCCACAGTGCCATCCACGGTGCCATCTACGGTGCCGCCGCAGTCACC
AGTGGCCTCGCAGCACCCACGACGCAAGTCCCGGGCACTCTCGCTGATCGGCCCCAAGCACACAGCACACACGGCACATA
CATCCCACATATCGCTCTCCTCGATCGACCCGGGTGCAGCTCACTACCAAAATCCCGAGGCGCGCCTGAAGCTGCGGGTG
TACCTGGCCTCGCCGCAAAAGTTCGACGAGGCTATCGAGTTTGGCTTTCCGTCGACGGAGGGGGTCTCGGATGCGGCCAC
TGGAGCGCTGGATGCCAATTCTCCGAGACGGAGCCGGAGCCGAATGCATTCGCGCCGCACTCTCTCGGACAACTCCAACA
CGATGCAGACGTTCCTGGACGACGACGATGACGACCGGCTAGACACGGACCAGGCTTCGGTGCCCGATCCCGAATCGCCA
CGGACGCCGAACCTGTTCTCGACGGCCGATACCGTGGTCGCCGGACACCGGCCATCGGAAAGTTACGCTCAGGCGCCGAT
GTCGTCGCGTGAGATGACGCTGCGCATGACGCTGACGCGGCCGGATCTACGCGCCTGTGAGGAGCTCATGTATGGCTGGC
AGCCGCAGCCGCTGCCGCTGGGCCGCAAGTCGCAGTCGCCGCTGCGCGAGGACCTGGCCATGGGCAGCAGCTCGCGGCCC
AAGGACAGCATCGACCAGCTGTTTGCGGGCATCGATCACTGGGGCCCAGACCCGCCTGAGAAGGGCATGATGAAGCGGTT
CTGGCACCGGATGCGGCGATCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62