GenePrediction:GLEAN_7262 Details

Name: GLEAN_7262
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3120641..3118399 (- strand)
Length: 2243
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3120641..3119018 (- strand)
Length: 1624
Type: CDS
Source: GLEAN
Position: GCSC_140:3118937..3118399 (- strand)
Length: 539
>GLEAN_7262 class=GenePrediction position=GCSC_140:3120641..3118399 (- strand)
ATGGCTTCTGCCGGAAAGGGTCCCGTAGCCACAGGGGCTTCGCATGCTGCGCTTCCCGGCCCCCCAACTCCGGCGTTTTC
CCCAGACCCTTCTGCCCTTTCTGCCGTTATCGACCCTGAAATCGACCCCTCTGCATCGGAAGCTACGCGATCAATCAAGC
GTCCACGCTCACCTTCGCTCGGCTCATCCGCTGCTGCCGCAGACATGTCCAGTATTGGCCTATCACCTAAAAAGATTGCC
CGGCTCGCTACCGGCTCGCGATTTTCCGATGCCACCGCCGAATTGACCTCCCAACCTCCCGATGACGATGGCCAAGAACG
CGTCGAACAAGAACATGCGCATGAGGGTGCCTCCGTGCTGCAGCCCCTAGGCGCTGATGACTACGCGGCACAGACAGCTC
TATCAGTCCTGCGCGGAGCTGAGGCCCTGATGTCTCAGAAAGCCGCGTCCGGGACCGCTACTACAGAAGTGGTAGCTGAG
GCTGCTGCTGCCGTTGCTGCTGCTGCTTCGGGTGAAAACGCAGGCGCTGAGAACACCGAAGATGCTGATGCGCAGATCAC
TGCCGACAACGCCACTGCCCTTGCTGAAGCGGCCGTTGAGGGGCTCGCTGCCGGCGAAGGCAATGTCCATGGTCACGGTC
ACGGCCATAGCGCAGAACAGATGGGCGTGGACACGCAGCAGAACCGGTCGAACTCTCTGTACGCTACCCCAGGCATTTCC
ACACAGACGGATACTGGCGATGTGCACGGATTGGCTGGGCCAGGGGCATTTTCAGAGCTGGTACCCAAATCGCCATCCAA
CAAGAAGCACAAGTGTCCTTACTGCGAAACCGAATTCACACGCCACCACAACCTCAAGAGTCACCTCCTCACACACAGCC
AAGAAAAGCCGTACAGTTGTCAAGGATGCGACATGCGCTTCCGACGGCTGCACGACCTCAAGCGCCACAGCAAACTGCAT
ACGGGCGAGAAGCCCCACATATGCCCACGATGCGACCGCAAGTTTGCTCGTGGCGACGCCCTGGCTCGGCATAGCAAGGG
TGCAGGAGGCTGTGCTGGGCGACGGTCGAGCTCGTCGGGCAATTTTGGTGGCGCGGCCGCAGACGAGAGCTTCGATGCCT
CCAGCATTGCCGATGCAGACAGCTCGGTCATGACTGGCATCGAGTACGACAATACCGATGACGACGAGCGCAGACGCCTA
AGTCTGCCGGTCAACAAGCTGCCGCATGGCCGGGGTCCCCGAACGTCCACAGACGTGTTTGGCGCACATGCACGGACGTA
TCCCCTCATGTCAGACGGACAGAGAGGGCCAGCAGTCAGCAGCCTTTATCCACCGAGCATCGACCGCACGCCCCCTGGGG
CGTCTTCGACTCCGAGTCTGACAAATGGGGCGTTGACGACGACAGCAGCCGGAAGGGGCCATACGCCAAGCACGAGTATG
CCGTCGATCCCGATCAGCACAGGCAGTGCCTCTCTTTTCTCGCAGCACGGAATTGCCGAGAGCCCCAAGCCTCTCAGCCC
TGCTGCTGGCCCGGATTCGAATGCTCTCCGACCGTCGGGTGCACAAGCACAATTCACGCAGGCACAGTTCACGCTGCGCA
GGCCCAACTTGGCGGAGCCGCATGGTGCGTTTGCTGCTGCCCGAGACGCTCTGATGAGTCCGGTGCGTTTTTCTTACTGA
CAATTCTAGTCTTATCCTCCACAGACCCGTTGCAGCAGATCAAAACCAATGGCCCCAGTGGCAATGGGGATACCAATGCG
AATATTTTCTCGTCCGAGCAGGGCATGTGGACGTATATTCAGACTCTGGAGAGCAAGCTCAAGGCGCAAGACGAGAAACT
GAAGCTGCAGGACGAGCGTATTGCGCTTCTGGAAGCATCGAAGCTTGGATATGAGGCCCAGATATCCAGCCTAACGAAAG
GGACCGCCGGCACGCGCAGCCAACCGACGACGACCGACGGCCAAGCACAGGCTGTGGCGATTTCCGTCGATCCGGTTCCA
GATACACAGCCGACAATGGGTCCGCTGATGGAATCTCAGATGGAACCGCCGATGGACCCGCCGATGGAGTCGCCGATGGA
ACAGCAGGCCGAGCAGCATATTGGACAGGAAGACCAGCAGACGGACCAGCAGAGAGACCAGCAAGCGGAACAACAAGCGG
AGCGACAGGCAGAGCGACATGCCGAGCAACAGCTGGAACAACACATCGGGCAGCAATTGGAGAATGCAATCGTGCAGCAG
TAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62