GenePrediction:GLEAN_7264 Details

Name: GLEAN_7264
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3102765..3100817 (- strand)
Length: 1949
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3102765..3102228 (- strand)
Length: 538
Type: CDS
Source: GLEAN
Position: GCSC_140:3102024..3100817 (- strand)
Length: 1208
>GLEAN_7264 class=GenePrediction position=GCSC_140:3102765..3100817 (- strand)
ATGGAGTCCATGATGTCCAACATCGGCCCGGCGTTCTACTGCTACAACCCAGAACAGAGCATGGCCGCCCGGCAGCACAA
CCACTTCATGCAGCACCACCAGATGTCGTACGCAGTGCCTACTCTGCCGTCAACACCCATCTACTCGCGGCCAAATTCGT
CGTGCTCGCAGCAGCAGATGCAGATGCAGCCGCTCAGATCAATGACCAGTGTGCCGTCGAGCATCATGGCCCCCATGCCT
TCGCCGCCGGCAACATCTTCGGCCATTATCAACGGCCACATCATGCACAAGCCGACTATCATGCTGGAGACTGAGCTCTG
CGACGCCGATGGCCTGCACTATCCGTCCACACCGCCGCTGTCGACGGTGTCCAGCGCGATCAGCAGCCCCGGCAGCTGTG
ACATGCTGGCCACGCCGCTGAACCCCATGTTCTCAGGGCTGGACAGCTTCCGCAACCTGAAGGAGGCGTGCCCGACCGAC
TTTGTGCCCGATAATGGGTCCATGACTGGATGGAGCTCTTCACCTCCGCTGACACCTGGTGAGTCTTGGTTCCGCAATCG
ATTATCCCATTCAATTCCACAGGGGACCAGAAGCGGCAGCCCGTACACCAATGAGCGGCCGAGGTGGTCTCACATACATG
ACAATAAATTTCTGCGGGCCCCTCGCTGCACCTTTCAATTCTTTCCGTCTTTGTGTCTCCCGAACACTAGTGAACAACCG
TTGCTAACGCATGCTCCCCAGTGTTTGTCCACTCCCACGCACAACAGATTCTGCCTATTGACAACTCACACGCGCCCATC
TCGGTGCACAACGAGCTGCTTTCCGTGTCTGCTTGCCCTTCTCTCTCACCTTCGCCTTCCCCGTACCCGAGATCCATTGC
ATCTGAGCAGGACAACGATTTCTGTGACCCTCGGAACCTGACTGTCAGCGCGGTCGACAGTGATCTGTCGACAGAATTCT
CTACTCTGCACTCTGATGTGGATGACGACTATTCCTTGAAGACGGAGCCGCTGTCGCCTGAAGCACATGGTGTGGCTGTC
TGTGCTGTTGACTTTGAGCAATCTCTTGTGCACGGTGTTACTGGCCTGGACGACTTTCCGGAGCTGGAGTCGGAGGATGA
CTTTGTAAATGGGCTGGTGAACCTTGGTGGTGAGCTGTCTGCTATCTCTGCGGGATCTCCGTCCGCGGACCTGGCCAGCC
GGTCACGCTCCAGCTCTTCGATCTCGGCGAACTCGGACTTTGAGTGCGATCAGTTTTTTGACACCTGGGACTCATCTCTG
GAGATGGAGGCCCAGCAGTCGCACAAGCGCCAGCGGACAGTGTCCACCGGCATGAACATTTTCACGGCCGCGTCAGACTC
TGCTGGCTCGAATGAGGTAGAGCAGGTGTCCAGTGTTTCGGACGAGCAGAATGACTCGTCGGACAACAACACAGACTCGG
CAGGATCTGCCAGCCCAGAGAACATGGATGGCAACAGCAACACGCCGAGCGTTCCGGTTTCGACGAACCGTCGGGGCCGC
AAGCAGTCGTTGACTGAGGACCCGTCGAAGATTTTTGCATGCGACCTTTGCAACCGGCGGTTCCGCCGACAGGAGCACCT
CAAGAGGCACTACCGGTCTCTGCACACACAGGAGAAGCCGTTCAGCTGCCACGAGTGCGGCAAGAAGTTTTCGCGGTCGG
ACAACCTGGCGCAGCATGCCCGGACACATGGTGCAGGTGCTTTCGTCATGAACCTGTACGACGACGCGGAGATTGTGGCG
GCGGCAACAGCATCGTATCCGCCACACCCCATGTATGCGCAGCATGCGGCTGCCATGGGCGATGACTTCTCCAACATGGG
ACGGGTGCTGTTCCAGGTGGCTGCAGAGATCCCGGGCAGCGCAAGCGAAGTGTCATCAGACGACGGCGGTGATGGCCAGG
GCAAGAAGAAGCGGAAGCGGTCTGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62