GenePrediction:GLEAN_7266 Details

Name: GLEAN_7266
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3095574..3093226 (- strand)
Length: 2349
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3095574..3093433 (- strand)
Length: 2142
Type: CDS
Source: GLEAN
Position: GCSC_140:3093297..3093226 (- strand)
Length: 72
>GLEAN_7266 class=GenePrediction position=GCSC_140:3095574..3093226 (- strand)
ATGGCGGCCACGGAGAAGCGGACAGAGCCTATGGCGGTGGACATTCCGGCGTTTGCGGCCGCGCAGCTGGACCTGCTAAC
GGCCGAGCTGCAGAGCGAGATGGCAGAGACGGCGACGGCCATTGGCAGCCACACGCCAGCAGCACTACAGCGGGCAGGTC
TGGCGTTGACGAACCTAGTCGTGGACGGACGGCGGACAGGCATGGGCGGGCGAACTGTGCTGACGCTGGTGCGTGACGGA
GCGCTGAGCGTGGCTAAGAACAGTGAAGACGGCAGCGAGCTGCCGGAACACGGCCTCCGGACCGGCGACATTGTATTGGT
GGCCGAGCAGCCAGGCGGCAGCGCGAAGAAGCGGGAGATGCGGGAGCTGGAGCAGCGAGGGTCACGAGGCGTGATCACGC
GGGTGCGGCGGACAGGACTGGACGTGGGGCTCGACCAGGGCGACAGCGACAGCAGCAGAGAAGAAGCCGTGGACGTGCTG
CTGGCCGGTCGCGTCTGGCTGGTCAAGCTGGCGGACGACGTGACCTTCCGGCGCATGTCAGCGGCGATGCAGACGCTGCA
GACGATGCCATCTAGCGAGTACACGAGCCTGATGCGGGTGCTCTTTGGGCAGGCATCGCCGTCGCCGGCGGCACGCGAGA
ACGAGGAGGACGCGATTCGCTGGATTGACGGCTCGCTGGACGCATCGCAGCGGGCGGCCGTGCGGTTTGCGTTGGCAGCG
CCCGAGGTAGCCCTGATCCACGGGCCGCCTGGCACCGGCAAGACGCACGCGCTGGTGGAGCTGGTCCTGCAGCTGGTCGG
TCGCGGCCAGCGCGTGCTGGTGTGCGGGCCGTCCAACATTGCGGTTGACAACCTGGTCGAACGGCTGGGACCACACGGCG
TTCCTATGGTGCGACTGGGCCATCCGGCACGCCTGCTGCCGTCTGTGGCCGGCTATGCGCTCGACGTGCTGACCCAGACG
TCCGAGGCCGGCGCCATCGTGCGCGACGTGCGTGCCGACATGGACAGACAGCAGGACGAGCTGCGGCAACTGCAGAAAGG
CCAGAAGCTGTCGGCCGCCGCTCGACGTGCGGCCCGTCGCTCTGTCTACGGCGAGCTGCGGGCGCTTCGCCGCGAATACC
GCGACCGCGAGCGGCGCTGCGTCCACGACCTCGTCGCCGGCAGCCGCGTCGTGCTGGCAACGCTGCATGGCGCCGGTGGC
AGCCAGCTGCGGGTGGCGGCCGGCGACCAGGCCAGCCGCAACTTTGACGTGGTCGTCATCGATGAGGTCGGCCAGGCACT
CGAGGCACAGTGCTGGGTGGCGCTGCTGGGCGCCCGCAAGGTGGTGTGTGCGGGAGATCACCTGCAGCTGCCGCCGACGG
TGAAGTCGAGGGGCAGTGGAGGGGGAGGGGGAAAAAAGAAGGGAGGAAAGGGAAAGGGAGGGAGTGGAAAAGGAGAGAAG
GGAAAGAGCGAAAAGGAAGATGGGAAAGAAGCCGAAAACGAAGCACACACCACTCTCTCCCTCGAATACACCCTCTTCGA
CCGCCTTCTCGCTCTACACGGCGACTCGATCAAGCGCATGCTGACGACACAGTACCGCATGCACGAGCGCATCATGCGCT
TCCCGTCCGACACGCTCTACGGTGGCCACCTGGTGGCGGCCGAGGCTGTGGCCGGCCGTCTGCTGCGAGATCTGCGCTAC
GGCGACGCAGACGACGGCTGTCCGGTAGCAGACACGGATGACACGCGCGAGCCGCTCGTCTTTATCGACACGCAAGGCGG
CGACTTTGCCGAGGGGGACCAGACGAGCGAGCAGACATCCCGAGGGAAACTCACCGACAGCAAACACAACACCTTGGAAG
CTGCCCTCGTGCGGCAGCACGTCCGCGCGCTCGTCGCCGCCGGCGTCCGGCCCCAGGACATTGCTGTCGTCACGCCCTAC
AGCGCCCAGGTGGCCCTGCTGGCGCCGCTCAAGACCGCCTTGGCCGGGCTCGAGGTCGGCACCGTCGACGGCTTCCAGGG
CCGCGAGAAGGAGGCCGTCGTGCTCAGCCTGGTGCGCAGCAACTTGACCGCCGACGTCGGCTTCCTGGCCGATCGCCGCC
GCCTCAACGTGGCCATGACACGGCCAAAACGGTCGCTCACCGTCATCGGCGACTCTGAGACTGTAGGACGGTGAGCTTTC
TTTTTTTTTTTCCCCTCTTTCTTTTTTTCCTCTTTCTTCTTTTCCTCCTCTCTCTTCCTTCTTCTTTCTTCCTCTTTCAA
CTGCTAACCAGCCAGAGGAAGCACCTTCCTCAAACAGTGGATGGCCTTTCTCGAAGAGCATGCCGATCTGCGCTATCCAG
ACTCGTCCGAGGCCGCAGCCGAGCCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62