GenePrediction:GLEAN_7267 Details

Name: GLEAN_7267
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3091863..3089252 (- strand)
Length: 2612
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3091863..3091096 (- strand)
Length: 768
Type: CDS
Source: GLEAN
Position: GCSC_140:3091033..3089252 (- strand)
Length: 1782
>GLEAN_7267 class=GenePrediction position=GCSC_140:3091863..3089252 (- strand)
ATGAACAGAGCCACCATGTTGAAGCCGCTCTCCAGCCCGGGTGTAGACCGGCCCAGGGCCTCGCGCCAGTCTGTCCGGGG
ACGCATCTCGGCTCCAATCCCCATGCCCGATCCCCTTGACCTCAAAGAGCAGCAGTCCGTCCCCAGTGAGTCTGGTGCTG
TGCATGAGTCCTGCCCGAGTCCCATGCCAAAGCCAGTCCAGTCCGCTTCTTTCGACCCGGAATCGGCAGAGGTCGTGCCT
GTGGTGGCGGCACCGGTCGAGAATGCCAAGAGCGCATCAGTACCCGACGCTTCCGGACCCCCTGCAACGACCTTTCCGCC
TGCATCGGCCTCTCTGCTTCCCTCCCCTCTGCAGAGAGAAGCAGGCACCAGCTCGCCTGCATCGGCTAGCCAGCTATCAC
CCGCTTCCACACCACAGCCGCGCCCTCTCTCGAAGCGACCGCCACCACATGCCATTGCCACCAGCTCGACTCTGCTCTCA
GACTCCCCTCCTACTGCCAGAGGCTCAAAACGCGTTTCCTCGGCCCTTCAGCAACGTGCCCCTCCAAATAACGTGCGATA
CTCTGAAGCCAGCGCCAGATCGGAGAACCCCCGAATCAGCCAGAGCAGAGATACCGGCAGCGACATAAGGCCTCAGCGGA
AAAAGTCTGGTTTTCGTGGCGCTTTCAGCAAGCTCTTCAGCCGCCGGAAGCACGTTGATAGCTTGCCCCCTCCCAGCAGC
CAAGCTTCTCATTACGACACCCCCCCACTGCACCGCAGCGTGCGTTCGGTATGTTTTTTTTTTTTTTTTTTCGTCGTCCG
CCTGCGCCTCCTCATACTGACTGCTACAAGGATCCCACTGTGCTCAGCATCTCAAAGGAGGCCGAGCCTGGGCGTTCGAC
CTCGCTTCCCCTCAGCGAGTATGGTCGCGCACTCCGGTCGCACTCAGTCGGTCCTGGCGCCATGTCGATCATTGACAGCG
TGCGGACGTCCCTACATGCTGACGGCCCGTCAACGGTCCAAGACGACGCCGCTCGCAGTCGCTCATCCGCAGCTACGGCC
ACGACGGTAACCCGCATGCGTATTGCACAGCACCACTTGCGCCGTGGTGCCGGGGGTTACGGAAGCAGCGGAGACATTCT
CGGCGGGGGGGAGTGGGCCGGCCTGTCTCCCCGACCTGCAAGCGTGCATGCCCGAGCTACTCACCATCCGCTCTCATCTA
CCGGCCTGGGTGGCGGTGCTGCCACAAGCCGAGGGAACTTGGCAGGCAATGTTGACGGAATCGTGCCGTATCGCGCTGAC
GAGATCGGCCGTGCCATCACATCTGACCTGGTGGGAGCGACAGACTTGGGTCTCAGGAGACGTTCTCGGTCGTTGTCTGG
TCTGCGCGACCTGACCTTTGGTCGGGACAGGTCCCGTCGCCGCAGCGATGAGATCCGTTACTGGCGTGAGAGCTACGATC
CGACGCTCATGTCTCCTCTCTCCGACGAGGATGCGGACGGCCCGGAGACTCGCACAGGCCACGCAGATGACAACGGCATT
GAGGGCCGGGACGGCGACGACGACGATGACGACATCCGTGAACGCGATCTTGCGCGTCGGCACAGTGGAAGCCCTTCGGA
CTTTCTCAATAATGGCGGGCTCAGTGGCGCCCTTCTGCCCAGCCTGCCTGCCACACCTGGCTCCCCGGACTCGCCGAATA
CGGCGATGCAACCGTTTTCCTTTGGCAACTTATCCGGCCTGCCCGAAATGCCACACACCGCCAACATGAACTCCCGTCTC
GACATGCTCGAGTCCCGCATGCATCGCGTCGAGCATGTCGTCGACCAGCTCTTCCACGCCGTGGCCGAGCTCAAGGAGCA
CCCGAGATCTGCGCACTCGTTTGCCAACGACACGGTCATGTACACCTCGCCATCAGCAACGGCAACAGCAGAAATGCGGC
CGATTTACACGGCCTCGACATCGGCCAAGCACCGCTTTGCTCCCGCCGCCTCATCACGCTGCAGCAGCCGCCATTCAGAC
CGCTCCGGCAACTCCACCGCCTCCTTCGACTCGGACATGCACCAGTCACACCTGTCCTTTGGCGAAGGTCGCACCTACAT
CGGCTCGCTCCACCCGCCATCGACGGCGGCCACGCAGGTGAAGCCTGTGCCCATGCCGGCATTCCCACCGTCAGTCGCAG
CCACAGTCAGAGAAGCGGCGAGCCTGCCGGCACTTGGCGCCTCCATTGGTCGCGGCACGTCGCCAGCCTCAGCCGCAGAG
ATGGCAGCACAGCTTGAAGCAGAGCGGGCTGCCCGCCAAACGCTCGAGGCCCAGGTCAAGAAGCTGAATGACCGCATCAA
CGTCCTCTCCACCACCATGTACGCCATCGTGCGCGACCCGGCAGCACAGCAGAAGCGCAGCCTTGAGCCTCTGTCCTCCC
CGGTGTCAAGCACAGGCAGCATCCGTGACGCTGTCGCCACAAAGCTCACGCTACCACAAGCCATGGGCAAGCTCGAGCGG
CCGTCGACCCGGGAAGACGGCAGCAGCAACGTCGACCCCAGCGGTGGCGACAGCCCCGAGCAGCAGCGAAAGACGTCCAG
GACTCTCAGCCTGGGCCAGCTGACGCTTGGCAAGAGCGCCGTGCGCGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62