GenePrediction:GLEAN_7268 Details

Name: GLEAN_7268
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3088404..3087427 (- strand)
Length: 978
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3088404..3088311 (- strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_140:3088247..3087779 (- strand)
Length: 469
Type: CDS
Source: GLEAN
Position: GCSC_140:3087478..3087427 (- strand)
Length: 52
>GLEAN_7268 class=GenePrediction position=GCSC_140:3088404..3087427 (- strand)
ATGTCGCACACGCAGTGGGTCGACTGGACGAAGACCACGCAGTCCAAGGACTACCGTGGCTCCAATTCATTTGCGACGTT
TATGATCATTGGCCGTAGGTGCTTATTGTTTGCGTGTGATTTCTTCGCGACGTTGCGCTGACCTCTTGCGCCGACAGCCG
TGTGTTTCTTTCTGGGCATCCTCTTTGCCTCCTTTCCGTACGACTTCCCGCTGCTCTGGACGTCGGACCCGGTACCGCCG
GCGTACTATGACCAGCTAGAGACGCACCTCAAGTTTGTGCACCAGTCGCCGCCGCTGATTGCGCGGCTGCTGTCGATGAT
CATCAGCGTCGGCTTTGCCGGCTTCTTCATCAAGCTGTTCCGGCCCTCCGAGGCCAACGTGCTGTTTGACGGCGCCAGCC
TGGTGCTCTACCTCATCGGCACCGGCGTCTACATTGCCAACATCGTCAAGGGCCTACGCACCGTCAGCGCCGGCATCTGG
GAGGACCCCGAGGCCTTTGAGACCATCAGCGGCCCGCTCACCGGCGAGGTCGTCCTCGGCCGCGAGGACAGCCTCCAGGT
TCTGTCTGCCTCCAACACCATCCTGGCCCTCATCCTCGTCGGCGTGCTCGCCCTGCAGATCGGCCAGTGGCACGCCGAAC
GCCGCGAGGCCGACGACGAGACCAAGCGCCGCTCCGGCCCCAGCAACAGCAGCAGCAACGGCAACAGCCACAGCAACAAC
AACAATAGCAGCCACAGCAACAACAGCAATGCTACCAGCAGCAGCAATGCTGCCAGCACCAAGAAGAAGCAGTGAGGGCT
TCCGCATCAGAGGACGAGAGGGAAAAGGCCTGCATGGCTGTGTGTGTTGGGTAAATTGGGAACAGCTGATACGGCATCGT
CGGAATGCCGGCAACAGCCGTGATATGGGACTCGTACATATTACAGTCTAGTCGTCGCCTACGTGCCAGATCAAGCAAAA
CAGCCAATACAACGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62