GenePrediction:GLEAN_726 Details

Name: GLEAN_726
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1666119..1667504 (+ strand)
Length: 1386
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1666119..1667018 (+ strand)
Length: 900
Type: CDS
Source: GLEAN
Position: GCSC_97:1667112..1667504 (+ strand)
Length: 393
>GLEAN_726 class=GenePrediction position=GCSC_97:1666119..1667504 (+ strand)
ATGGATGCCTTTGTGACGAGAAAGAAGCGCCCGGCTGACGAGCCGTCGACGAGACTTTGCAATCGGCCGGGAATTGACGA
TGACGACGCCCCGACAGAGGTCAAGCTGGCATTGCTGGCCTCGCTGCTGGATGGCGACATGGACCAGGACGTGCTGCTGG
ATGTATTGCTGGCCCACGACGGCTCCGTCGCTGCCGCCGCCGAAACGCTCCAGAGAGGACCAGCAGCAGCAGCAGCACGA
CGAAAGCGGCCGCGTGCCAGCAGTGGTGCCATCCAGCAGACATCGCTGCGCGGATTTGCCACGCAGTCGACGCAGACAAA
GCAGGTCCTCCAGGTCCAGCCGCTTCTCTCTCGACGCGGTCGCACGCTGGATCTCTTCGACCCCGTCGACGTCGAGGCTC
ACACGCCTTGCACTCTGCTGCACAACTTCTTGCCAGCCGACACGGCCAATGCGCTGCTGCATGAGATGCTGGCCGAGGCA
CCCTCTTTTGCCACTCCGCGCTTTCAGCTGTTCGAGCAGGTCGTCACGAGTCCCCACACAATGGGCTTCTTCGTCGATGA
CGGCCTGGATGTCACGTCGGTTCCGACCTCCACCACACCCTACCTCTACAACGGCTCCCGCATCGACAACGTTCGCCCCA
GCACGCCACAGCTGGCCGCTGTCCGCCCCATAGTTCAGGCCGCCGTCAATACTGCTGTCCGCCAGCGCATCGCCGCCCGC
TATCCCGGCGGCTGCAAGCTGCGCCACCAGCATCCCGGTCCCTGGTGTCCCAACGCCGCCTTTGTCAACTGCTACAGCGG
CCCTCAGCAGTCCGTCGGCTGGCACAGCGACCAGCTTACCTACCTTGGCCCACGCGCCGTCATCGGGTCGCTGTCCCTCG
GCGTCACTCGCGAATTTCGTGTCCGTCGCGTCATTGCACGTGACCGCAGCCTCAACAACGGCAACAACGACAACAACGAC
AACCTGAACAACTTCGACGACGCTGCTGGCCAGATCAGCATCCATCTTCCCCATAACTCCCTGCTCGTCATGCACGCCGA
GATGCAGGAGCAGTGGAAGCACTGCATCGCCCCCACTACCTCTATCGACCTTCATCCTATCGCCGGCAACAAGCGCATCA
ACATCACCTACCGCCATTATCGCCCCGAGTTCCATCCCAACAACACCCCCCAGTGCCGCTGTCGAATCTCCGCTGTCCTT
CGTGTTGTTATGAAAAAGAAAGACAACTACGGCCGCTACTTCTGGATGTGCCATGCCGGCAACATCCCTGACAACCCGGG
CTGTTCCTTCTTCCAATGGGCTGAGTTTGACGATGACGGATATCCTATTTGGAGGCACAAACCACGAGTGGCACTCGAAC
AGACAGACAGTAACAAAGTCAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62