GenePrediction:GLEAN_7274 Details

Name: GLEAN_7274
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3052989..3051646 (- strand)
Length: 1344
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3052989..3052939 (- strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_140:3052875..3052790 (- strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_140:3052712..3052038 (- strand)
Length: 675
Type: CDS
Source: GLEAN
Position: GCSC_140:3051982..3051646 (- strand)
Length: 337
>GLEAN_7274 class=GenePrediction position=GCSC_140:3052989..3051646 (- strand)
ATGGCCGCGAAACAGATACCGGTGTGGCTGGACTGCGACCCGGGCCACGATGTGAGTGCGGGGAGGGGGATGACAGGCCG
GAACGAGTTGATGGACTGATATGCTGGACCGCAGGACGTCTTTGCCATTCTTCTGGCAGCCTACCACCCATCGATCCGGC
TGCTGGGCATCTCGACCGTGTTCGGGAATGCGTCGCTGAAGTGAGCAATGGCCGACCGACAAGAACGAGCGGGGAGCAGT
GAGGCTGACTACTTTCATTTTTCTCTGGTTCTAACAGACACACGACCTGGAACGCGACGTCTGTGCTGACGGCCCTTTCC
AAGGAGGAGGATGTGTCGGTCTACGAGGGTGCAGCACAGGCGCTGGTGCGGCGACCACTGCGAGAGCCGGCAGCCGACAT
CCACGGCGAGACGGGTCTGGACGGCACGGCGCTGTTGCCTCAGCCACTGCGGCGGCCGGCCGACGACGTGAGCGCAGTTG
AGGCTATGGCACGTGCTCTGATGGTCGAGCCGGCCGGAACAGCCTGGCTTGTGGCTACGGGCACGCTGACTAACGTGGCC
GCCATGTTTGCAACGCATCCGACGCTCGTCGAGCACATTGCCGGCCTCTCCATCATGGGCGGCGCCATCGGCGACGGCTT
CACGGCGGCTGTGGCTGGCACCGTCAACGGGAGACCGCGCATCGGCAACACGACGCCCTTTGCCGAGTTTAATATTCTGC
TGGACCCCGAGGCTGCTGCGGCGCTGCTGCACAACCCCCGGCTCGCCCGCAAGACCACGCTGATCCCGCTCGACCTGACG
CATCTCGTGCTTGCCACAGCATCCGTGCAGGACCTGCTGCTGCACGGGCCTGAGAGTGTCGGCAAGGAGGCCAGCAGCAG
CAAGGCCGGCGGCAAGACCACCCTGCGCACCATGCTGGTAGAGCTGCTCAACTTCTTTGCCGACACGTACAAGTATGTCT
GGACTCCCTCTTCCTTCTCCCGCTCCGGCCCTTGCTCACGCTGCCAGGAACGTGTTTGGCATCGTCGAGGGTCCCCCCCT
ACACGACCCGCTGGCTGTGGCGGCCGTGCTGATCGGCACCGCGGCTGAGATCCCGTTCTACGACTACACGGACGACGACA
GGTCCCGCCACGAACGCTTCGACGTGCGCGTCGTCACCGACGGAACCAGCGAGGAGGCGCTTGCTGGCACGACCGAGACC
GGCCGCACGGTGGCGCGGCTGCTGGAACCTGGAGCCGAGGGCGTGCGCATCCCACGCGGCCTGGACATCCCGATGTTTTG
GCGCGTCATCGAAGAATGCTGCACGCGGGCAGACGCTGCCAACGCCGAAAAGGGACGCAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62