GenePrediction:GLEAN_7275 Details

Name: GLEAN_7275
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3046774..3045389 (- strand)
Length: 1386
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3046774..3046670 (- strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_140:3046569..3046407 (- strand)
Length: 163
Type: CDS
Source: GLEAN
Position: GCSC_140:3046349..3046039 (- strand)
Length: 311
Type: CDS
Source: GLEAN
Position: GCSC_140:3045967..3045389 (- strand)
Length: 579
>GLEAN_7275 class=GenePrediction position=GCSC_140:3046774..3045389 (- strand)
ATGGCTTCCGTGACCGTCGAGAGCGCCTCGCCGATTGGCATCGCCAATCTTCCTAACCAGCGGCACAAGATCGTGGCCAA
GAGAGGAGCTGCCTTTACCATCATGGTAAGAATGCCGTCGTTCGGACGTCTCGTGCAGACGTCTCCCCCCGGCTGCTGGT
CTTGTCCGCTCTTTTGGCTGACCCCCTTTTTTCTCTCGTCTTCAGGTTGCCGGCGAGTCTGGCCTGGGCAAGACCACCTT
TATCAACACCCTGTTCTCGACCACCATCAAGAACTATGCCGACCACAAGCGGCGCCACCAGAAGCAGGTCGACAAGACGG
TCGAGATCGAGATCACCAAGGCCGAGCTGGAGGAGAAGTTCTTCAAGGGTATGACGTCCGGCACGTTTTATATTACCCTA
TCGACACGATGCTAACGCTGCCCAGTCCGTCTGACCGTTATTGACACGCCCGGCTTCGGCGACTACGTCAACAACCGGGA
CTCGTGGATGCCCATTATCGAGTTCCTCGACGACCAGCACGAGTCGTACATGCTCCAGGAGCAGCAGCCCCGCCGCCAGG
ACAAGATTGACCTGCGTGTCCATGCTTGCCTGTACTTCATCCGCCCCACCGGCCACACCTTGAAGCCTCTGGACATTGAG
GTCATGAAGCGACTCTGCTCGCGAGTCAACCTGATCCCCGTCATCGCCAAGGCCGACACGCTCAGCCCGGCCGACCTGGC
CCGGTTCAAGGAGAAGGTAAGCAGCGCCCCCCCTGAGATCGGACACTGGCTTTGCTGTTGCATCGGCTGCTGACGGACCG
CGTGCAGATCCAAGCCGTCATCGAGGCCCAGGGCATCAAGATCTACCAGCCGCCCGTCGAGGAGGACGATGAGGCGGCGG
CGCAGCACGCCCGCAGCCTGATGGCTGCCATGCCCTTTGCGGTTATCGGCTCAGAGAAGGACGTGAAGACGGGTGACGGC
CGCATCGTCAAGGGCCGGCAGTACTCGTGGGGTGTTGCCGAAGTCGAGAACGAGGACCACTGCGACTTTAAGAAGCTTCG
GTCCATCCTGATCCGCACTCACATGCTGGATCTGATCCACACAACCGAAGAGCTGCACTACGAAGCCTACCGCGCACAGC
AGATGGAGACGCGCAAGTTCGGCGAGGCCCGTCCCCGCAAGCTGGACAACCCCAAGTTCAAGGAGGAGGAGGAGACCCTG
CGCAAGCGTTTTACCGAACAGGTCAAGATCGAGGAGCAGCGGTTCCGGCAATGGGAGCAGAAGCTTATCGCAGAGCGCGA
TCGCCTTAACAAGGATCTCGAGCAGACCCATGCCCAGATCAAGCAACTGGAAGCAGAGCTTGACTCGTTGCAGGGCCCTG
CTATTCGCAGCCACGGCCGTCGTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62