GenePrediction:GLEAN_7276 Details

Name: GLEAN_7276
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3041651..3036218 (- strand)
Length: 5434
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3041651..3041423 (- strand)
Length: 229
Type: CDS
Source: GLEAN
Position: GCSC_140:3041331..3041184 (- strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_140:3041083..3040627 (- strand)
Length: 457
Type: CDS
Source: GLEAN
Position: GCSC_140:3040557..3039612 (- strand)
Length: 946
Type: CDS
Source: GLEAN
Position: GCSC_140:3039541..3038892 (- strand)
Length: 650
Type: CDS
Source: GLEAN
Position: GCSC_140:3038825..3038650 (- strand)
Length: 176
Type: CDS
Source: GLEAN
Position: GCSC_140:3038595..3038163 (- strand)
Length: 433
Type: CDS
Source: GLEAN
Position: GCSC_140:3038102..3037785 (- strand)
Length: 318
Type: CDS
Source: GLEAN
Position: GCSC_140:3037717..3037588 (- strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_140:3037071..3037013 (- strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_140:3036929..3036834 (- strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_140:3036490..3036218 (- strand)
Length: 273
>GLEAN_7276 class=GenePrediction position=GCSC_140:3041651..3036218 (- strand)
ATGTGCTTCACGCCACAGTGTGCTTTGACTTTCGCTAAAACAGGCCTCGGTCTCCCACGCGAACAGGATCCCAATCACGA
TGCGGATGTTCCGTACCCCATGGAGACCGACGATGTGCTCACCGGCCCACCCGTGAACAGCACATCCGACAACGACTCAG
CCACAGATACAACTCCGGATGCCCCGATCGGCATGGACACAGAGTCCGATCAGCCCCTCGCAAATGACTGTACGTTCCGC
TGTCGCCAACCCCTCTTAGCCTCTCCCCTTGCGAGGTACGCTGGGCCGCTCTGCAGTGCTAACCGTTGTCCAATGATCAG
TCGAGGCTATGAAGGAACTGATCCTCACCCCGTTGATCGAGGAACCTCCCATTTTGGATGATGTCATCGACACCTGGACG
GTGCCCCAGTGGCGGACGCTTCGTAAGAAGGAGCATGGGCCCGTCTTCAAGGCTGGCGGATATCCTTGGTATGATAGCTC
ACCCGGTCTTCAGGACCGTCCTCTCCAGCTCTTTGCGCTTCAATCGGTGCGACTGCATACTGACTGCAGCTGGTATCACG
TCTCACAGGCGCATATTGCTCTTCCCTTACGGCAACAACGTCGACCATTGTTCCGTCTACCTAGAGCACGGTTTCGACGC
AAACGAAATCCCCGACGACTGGGTGTGCTGCGTTCAGTTCTCCCTGGTCGTCTGGAACCCCAACGACCCCTCCATCTACA
CACACCACACCGCACACCACCGCTTTACAAAGGAGGAAGGCGACTGGGGCTTTACCCGTTTCGTCGAGCTTCGCCGGATG
CTCCACAAGTCCGAAGGCCGCTCAAGACCTCTCATCGAAAACGACACGGTGAACATTACGGCCTACGTCCGCATCGTAAA
GGACGAGACAGGTGCGCTCTGGCACAGCTTCATCAACTACAACTCCAAGAAGGAAACGGGTTATGTTGGTATGAAAAACC
AGGGCGCCACCTGCTACCTCAACTCGTTGCTACAATCCCTCTACTTCACCAACATTTTTCGAAAGGTGAGTCGTGTCCCG
ATATTTCAGGCCTGGTGTCCCGCTCGCGGCTGCCTTGCTAACATGTCACCAAAGGCCATCTATGAAATCCCCACTGAGAC
CGAAGAGAGTCTCAGCAACAGCGCGTACACACTGCAGCGACTGTTCTACCAGCTGCAGACGTCAAATACCGATGTCAGCA
CCAATGAACTGACAAAGTCCTTTGGTTGGGAATCAAGGCATATCTATGTGCAACAGGATGTGCAGGAGCTGTGTCGCAAG
CTTATGGAGCGCATGGAGGAGAAGATGAAGGGTACGGCTGGCGAAAACTTCCTCGCCAAGATCTTCTGTGGCAAGGTCAA
GACGTACATCTCCTGCATCAACGTCAAATATGAGTCTAGTCGCATCGAGGATTTCTGGGACATCCAGCTAAATGTCACGG
GGAACAAGGATCTGCAGGCGAGCTTCGAGGACTACATCAACGTTGAGAGAATGGACGGCGACAACAAGTACTTCGCCGGC
GACAAGCACAAGCTGCAGGACGCCAACAAGGGCGTCATCTTCCAGAGTTTTCCTGATGTCCTGCATCTGCAACTGAAACG
CTTCCTGTACGACTACTACAAAGACGCGCCGATCAAGGTCAACGACCGACACGAGTTCCCCGAATTCTTCGACGTGGAAC
CCTTCCTAGCCAAGGACGCCGACCGCTCTGAATCGTGGGTGTACCAGCTTCACGGTGTTCTCGTGCATAGTGGAGACTTA
GACGCCGGTCACTACTACGCATACCTGAAGCCGAAGAAGGACGGGTGGTTCTACAGGTATGACGACGAGAAGGTGACAAA
AGCTACGAAGCGAGAAGTCCTAGAGGAGAACTATGGCGGTGCCTACCCGCCCCTACAAAACCCATACGTGCGCCCTGGTA
CGAACAAAAAGTCGCCTGTTATGCGTCCAAACAGCGCTTACATGTTGGTGTACATTCGCCAATCGCGGGTCGATAATGTC
TTGACTCCCGTTACCGAAACCGATATTCCCAGCCACATCCGTACGTCTTCTCCTTCTGCATCATTCACAGCTGCCTGCCA
GTCGGGGTTGGTGAGTACTGACATTGGTAGAAAACCGCTTCCTCGAGGAGGCTGCAGCGCGCGAGGCCAAGCGCAAGGAG
CGCGACGAACAGCACCTGTACATTGGCATGAAGGTCATCTCAACCGACACGTTCCGCGGTCACTCCGGATTCGACCTGAC
CAACTTCGACGCCATCCCCGACTCAGACCCTGCTGCCCCTAGAGTTTACAGGATATTGCGTACGACAACGATCCAGGAGG
CCATTGCTGGTATCGCGTCGGATATGAGCGAGAATCCCAAGAAAGTGAGGTTATGGCTAATGGTCAATCGCCAAAACAAA
ACGATCCGGCCAGATCAGCCAATCATGGATGTGCACTTGACTGTCGAGGAGACGTATACGCGCATAGCTTCTCACAGAGA
CAACATGCTCCGCGTATGGGCTGAGGTGGCGGACGAGGTTGGACCTGATGGCGAGCCCATTTGGCCCACCTTCCAGAGTC
AGCCTAACGGGCAGGTGGTTAGGAACGACCTCATCTTCATCTTCCTCAAATATTTCAACGTTGAGGAGCAGACAATCAGC
GGTGTCGGGCATGTCTACATGAACAAGGAAAAGAAGGTGGAGGAGCTGCTTCCCCTGATCATGAAGAAGATGGGATGGGG
TGACAAGCTGTCGGATGGTGAGAAGATTTTGCTTTGGGAGGTAAGTCGTCTTTTCGCTTGCTGCAATAAATGCATTGAGA
GCGGTGTTGGCTGATATCACATACAGGAGATCAAACCGAACATGATCGAGTCTTTGAAGCTGAAGCAGACCCTGAAGGCT
GCAGAGCTGCAAGATGGAGACATCATCTGCTTTCAACGCCAGCTGGACCGGAAACCGTCGGGTCATTTCCTGGATAAGAT
TACCAGTGATAAATCATCGACAGGGGACAAGTCCTCCAGCGTGTATGTGCATTTCACACCTGTTCTGGGACTCTCTTACT
AACTCACTTGTTTCAGTGTCAAGAAATGGGACTGGTTCGCCGATGCCAAGGGATACTATGAGTTCCTGCTTAACAAGCGA
CAAGTCCACTTCATGCCTCATCCTACACGGTGTGATACAGAAGCATATGGTCCGTTCGCCCTCATGCTGAACATCCGTAT
GACGTACGACCAGCTATCAGAGCGGGTCGGGAACCAACTCCAAGTCGACCCAACACACCTGCGTTTCTACACTGTGAACA
GCAACGCGTCGGGAACTCCAAGAACAGTTGTCAAGCGCAGCGTTGCCCAAAATCTCAACACCATTCTTACTCCGCAGGGC
TACGCCTCCCTGGGCACTTCTCAGAAGACAGACGCTCTCTACTTTGAGGTTCTCGAGATGAGCCTAGCCGAGCTGGAAAC
GAAGAAGGGTATTAGGCTTATCCTTCTGAGCGAGGGCATCACAAAAGACGTAAGTCCAAATTCGAATTATCCATGGCCGG
GAAGACGCTAACGTTCCGTTGTACTACAGGAAACATTTGATCTCTTCGTCAGCAAGAATTGCACGATTGAGGACCTCATT
GAGGCGCTCGTCCGAAAAGCCAAAATCGCGAGCGAGGCGGAAGGTGGAAAGATCCGCGTCTATGAGACAAGCGGCATGAA
GTTCTCTCGCGACCTCTCCCGAGACTACCCGGTTGTGAGTCTGAACGACTACTCGCAGATTGTAGCGGAACGAATCCCGA
AAGAGGAGGTCGAGGCGGCCGAGGATGCGCAGACTATACAGGTGTTCCAATTTCACAACGACCCGAGCAAGGTTCACGGC
ATTCCGTTCCGGTTTTTGCTCAAGGAGGTACGTCTGATCAGAGCCCAGGAGCGGATGAGTGGTTCAGCACTGGCCAAAGC
TAACTTATGTCTAGGGTGAGCCGTTTTCTGAGACTAAGAAGAGACTCGAAATACGGACTGGGTTCAAGGGCAAGAGCTTT
GAGAAGATCAAGTTTGCTCTCGTGCGGCGGATGCCCTATTCCAAGCCACAATATTTGGAAGATGGTGAGCTTGCACAATT
TCTTTTACGCGAGAGCGGCCGAGTTCTAACATGTTATAGATGACATTCTATGGGATCTCACGAACCATGAGGACGACTTT
TTGGGGCTTGACCATGTTGATAGATCAAGAGGCCTGCGTAACGGGATCGAGGATTTGTTTTTGCACTAAACGGCGGTTGG
TGAATACAGGGTGTAGGATGGGGGAAAAGGCCATCTCTTAGCACAAAGTACCAGTAAATACAGTTGGAGCCCATGTGCTG
TATATTCCGCGATGCTTGCATTTCAATGATGCCTCGGCGGCGTCGAAGGCGATAGTTTGGGCGGTGAGCTGCGGCAGAAA
TAACAAGTCGATAAGACTTTTGTCGCAGTGAAGGAAGACCAGTCCATACAACTAGCTGTACTGAGGGTCACAGCAACGCA
GAAGATTCGCTCGATCCTGTCTCGGCCTTTTCTTCTTTTTCAGGTCGCCTCTGTCATTTCGACATTTGTACGCCTCTCGT
TTGCGACATGAACTTCCCAGGGGCGGGCCTTCCGACTGGGGGCGGGCCAAACGGTGCGGACGACCCCAATGTCAAGAGGG
TGAGACAAGATGCTGCGATCCGGGTAGAGAGCTTGATGTTTATGATTTGGATGTGTTGGTCTGACTGTGTTTGCACGAAC
AGGTCCAAGCGCTGATGGAGTCGTGCTTTGCTAAGACGGCCATGTCTGGTGTGGCTGGATTTGGTCTTGGTGGTATATTT
GGCATGTTCATGGCATCAGTACGTCGTCAGGAGCGGGTTTTGAAGCTGGGGTGCATTCTTACCAGTGCCGTAGATGTCGT
ATGACACGCCCTACCACACGGCAGTGCCGACACCCACGCCAGCAGCGGGAGCTGTGGCAGCTACTGGGACAGCAGCAGCA
GCAGGTTCTACTGGAGCTGCAGGAGCAGCAGTGGCAGCAGGGAAGCCAGCCGTACCAGGAGCAGTTGTATCTACGGCAGC
GACGACGGCATCGACAACAACATCGACGGCAGCAACAGTGACAGCAAAGGCGCTGCCCAAGGCGGCACCAGCAGCCGTGC
TCACGCCCGAGACGATCTCGTCTCTGCCACTACGCCAGCAGCTAGCCTACGGCTTCCGCGACATGGGCTCGCGCAGCTAC
TCGACGGCCAAGAACTTTGGCAAGGTCGGCGCGCTCTTCTCCGGCATCGAGTGCGGCATCGAGGGTCTGCGGGCCAAGAA
CGACATGGGCAACGGCGTGGCGGCCGGCTGTCTGACGGGCGCGATCCTGGCACGCAACGGTGGTCCGCAGGCGGCGGCGA
TCGGCTGCGCCGGTTTCGCGGCTTTTTCGGCAGCCATTGACGCGTACATGCGGATGCCGCCGAGCGATGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62