GenePrediction:GLEAN_7277 Details

Name: GLEAN_7277
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3028100..3026031 (- strand)
Length: 2070
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3028100..3028026 (- strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_140:3027960..3027949 (- strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_140:3027853..3026298 (- strand)
Length: 1556
Type: CDS
Source: GLEAN
Position: GCSC_140:3026226..3026031 (- strand)
Length: 196
>GLEAN_7277 class=GenePrediction position=GCSC_140:3028100..3026031 (- strand)
ATGGCTGTCCAGACGGCGCTCGCCCAGATCACATCGATCTTGATACGAATTTTATCGTATTTCTTCCTTCGTTGGGTGAG
CACAGTTGGAACCCCGGTTTTCTCGCCTGATCTACTAGCTAACAACACCAAACCGGTTAGGTTTCTGCTCCTGTAAGTCA
GCTCTCGTGCTAATCTGCGATCTACAGAAATCATAGGGCAGCGGGAGATGAGCCTCGATGGGCTGAAGAATTCTAACCGC
TCGGCAGATCGTCCCCCCGGTTATATTCAGCCTCCTCGCCGTCAATGTGCCAGCATTCATTTTCAGCCATTGGGCTGAGC
CCAAATACGAAGTGGTCGGAGAAGAGATCGACATAATTGTCACCGACACCGAGGTGACGAACGAGAATGGAGACGGTTCT
GAGATGGGAGAGGTGAACGTTTCCGATACTGTGATTCTCGGAAGGAGGTCCATATCCCCATGGAGAAGTCTTCTCTTGGG
CGCCCCAAGCCCAAGCAAGCTGCTGTCGCTTCTGGCTGTGGCCATCAACGTCGCCCTGGTCGCTATGGTTGCCGACCGCC
TTTTCTCTGAGCACTCAGTCACCGCCGCCGACTTGTCGTTTGTGCGCCCAGGGTATATTTCGGACACGCAGGCCAAGTTT
GTCATCCGCGAACCGGACCAGTCCAAGATGCCCGTCTCTATGCAGATCCGGATCAAGGATGCTCAGCCGCCATTTGACAG
CCCTGTCTGGCAGACGGTCGGAGGCACACGGTGGACCGATAATTCGACCGACTACACTGTCGTGTTGACCGTCCCGCTGC
AGAACCCGGTCCAGCGCATTTATGAGTGGAAGACGTCCAACAACCACTCGGGCGAGTTCATGGCTGGTCCGAAAGCTGGC
AAGGCACCTGCCCTGTTCAACGGCAGCTTTACCTTTGTCACCACCTCATGCGTCCTGTCACGGGTGCCTTACTCCCCGCT
CGACCACCCGCTGGCCATTCCGGGCCTCCGGTATTTGGCGAACGTCTTGCCGAAGCTCAATGCGCAGTTCATGCTGTTTC
TGGGCGACTTTATTTACAGCGACGTGCCGCGTTATTGGGGCAAGTCGGTCGAGGACTACCGTCAGAAGTACCGACAGGTG
TATGCATCGCCGGACTGGAAGGCCGTGGGCCAAAATCTGAGCTGGATTCACGTGCTGGACGATCATGAGATCAAGAACGA
CTGGTCGGAAAACAGTACCGGTGTCTACGAAGCGGCTGTCGACCCTTGGCACCACTACCACACAGGCGCGAACCCCCCGG
CTGCCCGGCAGGCAGGTACTCAAAGCCTGCGTCCCGGTGCAACGTATTTCGAGTTTGCGCAGGGTCCGGCAAGCTTCTTT
ATGCTAGACACGCGCTCGTACCGGTCCAGCAACAGTCTGCCGTTCAACAGCACGGATAAGTCGATGCTGGGCGCAGAGCA
GCTGGCGGACTTGCTGGACTATCTGCGTCGGCCGGAGCCCCGGGGCATCAAGTGGAAGATTGTGGCGTCTTCGGTGCCCT
TCACAAAGAACTGGCGCATCAATCGGCGCGATACTTGGGGCGGCTTCCTGTCTGAGCGCCAGGTTATTTTCGAGGCCATG
TGGGATGCTGGTCTGCGTGGCACTGGAGTGGTGATCTTGTCGGGTGACCGGCATGAGTTTGCAGCCACCCAGTTTCCCCC
TCCGGCCAATTCTCAGTGGCCTGCAAGCGTTGCGGTGCACGAGTTCTCGGCAAGCCCACTGAGCCAATTCTATTCCCCAG
TCCCTTCCTACTTCCAGTGGGACGACGAGGACGTCAAGCTTGAGTAAGTGTATCTATCAATCTCATCAGTAATAAAACGA
GAAGAGGAAGGCGGCTGCTGACATTGGCACCTAGATATATCCACCGGGGAAACAGCAAGTTCGGGGCTGTCACTATCAAC
CAGACCATCGGAGAGAGCGACCAGAGCAATCTACATTACCGTCTTTTTATCGATGGCGCTGAAACATGGAACACAACGAT
CGTGTCTCCTGTGGCAGTGATAGAGGAGCCGAAGAGCAGTTCAATTTGGAATAAGATTCTGGGTCGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62