GenePrediction:GLEAN_7278 Details

Name: GLEAN_7278
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3023307..3018585 (- strand)
Length: 4723
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3023307..3023060 (- strand)
Length: 248
Type: CDS
Source: GLEAN
Position: GCSC_140:3023000..3022946 (- strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_140:3022791..3022731 (- strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_140:3022674..3022587 (- strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_140:3022537..3022429 (- strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_140:3022361..3021683 (- strand)
Length: 679
Type: CDS
Source: GLEAN
Position: GCSC_140:3021603..3021533 (- strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_140:3020542..3020335 (- strand)
Length: 208
Type: CDS
Source: GLEAN
Position: GCSC_140:3020257..3019668 (- strand)
Length: 590
Type: CDS
Source: GLEAN
Position: GCSC_140:3019592..3018682 (- strand)
Length: 911
Type: CDS
Source: GLEAN
Position: GCSC_140:3018597..3018585 (- strand)
Length: 13
>GLEAN_7278 class=GenePrediction position=GCSC_140:3023307..3018585 (- strand)
ATGGCCGTCTACCGTCTTCCCGTCACTCTGGCGTCTCTGGCGCGTTTTGGCCTGCGCATGCCGACCGCTGGGCGAGCTGT
GTCTACTCTGCCTGCATTGAGGCGCCTAACGGCGCAAAAAGCGGCACAACGGAAGCTTCCGGTCAGCGGACGACAGTATT
CTCTGCTGCTCAGCCGTGATTCCAAAGTGACTGCTGGCGATGCGTCCATTCAGATTGCCTCATCCGGGACCGTCAAGCGT
ACTGAGCTGTGAGTTCTGGGCCCCTGGCCAGCCAATTGCTCCCGTCCGATGCTGACTCTCTTCCCAGACCAAACATATGG
CTCCGGTATGTATCGTATTGCCTATTCTGGAATGAATTTGGCGTACGGACTTCTCATGCGTGGGAACTAGGGACAACTGC
CGGTGTGCAAGCTGCGTGAATCAGGACACGTCGCAGCGGAACTTTGACACGTTCAAGGCAAGCAGACCTCGGATGGCCTC
CGGCGAGACGGAACAAGTCTGACCCCCTTTCTGCAGATACCGGCCAATATTCGCGCACGTGACGTGGTGGCCGACGAGAA
GGGCCTGAATGTGACATGTAAGACCCGTCAAGGACCGCTCTCCTGGCAACGACTGAATGCTGACGATGGCCAGGGTCTGG
TGACAATCACAAGAGCAGCTACCCGTGGGATTTTCTCCAATTCTACCAGGAAAACAACTTCCGGGCTCCAGAGCCGGTCG
AGTATGTGCCCATCCAGACTCTCTCTGCAACGAGGGACTGACACGTGCAGATTCCACTACTGGGGGCGGTCTATCGAGCA
GGACCCGCCGTCGGTGGCCTATGATAGCGTGATGAAGGCCGACTCGGACGTGGGAGTTGCCAAGCTGACGGACCTGATCG
TACGTTTCCTCCCCCTTTCTCTTCCCTCCGATGACCGGTGGGACTGATGCGGCTTCGTCTGTACAGCGCCGGTTCGGCTT
CGCCTTTGTGGACGGCACGCCGTCGGCCGACCCCGAGGATACTCGACGGCTGCTGGAGCGCATCGCGTTCATCCGGGTGA
CGCATTACGGTGGCTTCTACGACTTTGTGCCTGACTTGGCCATGGCCGACACGGCCTACACGAACCTGGCCCTGCCGGCA
CACACGGACACGACGTACTTTACGGACCCGGCCGGCCTGCAGGCCTTCCACCTGCTGTCGCACCAGTCACCACCGGGCCA
GCAAGGCCAGCTCGGCGGCGAGTCGCTGCTGGTCGACGGCTTCCACGCCGCCCGTCTGCTGCAGCACGAGGACCCGGCCG
CCTTCGACGTGCTGACGCGCGTGCGGCTGCCCTGGCACGCCAGCGGCAATGCCGGCATCACCATCGCGCCCGACCAGCGC
TACCCGGTGCTGGAGCTGGACGACGCAAAAGCCGTCCATCGCGTCCGCTGGAACAACGACGACCGCGGCGTCGTGCCTTT
CGACGGATATATCGACCCCGTCCGCTGGTACGATGCTGCCCGCCGCTGGTCGGCCATCCTGCAGCGGCCCGACGTTGAGT
ACTGGACTCAGCTGACGCCCGGCCGCGTGCTCATCTTTGACAACTGGCGCGTGATGCACGGCCGCCGCGCGTTTGTCGGC
CTGCGCCGCATCTGTGGCGGATACAGTCAGTCTTTCTCGTTTTCTTTTGCGTCTCTTTTTTCTGGCTTGTTTTGTCTTTT
TGTTCCGCTGCTGACAGCTCCCAGCCGCTCGCGACGACTTTATCTCGCGCTGGCGCAATACGAACTATCCACGTGCGCAG
GTCCTCAAACAGGTGGTAGGATAATCTGAGGACGAGTAATAGCAACAAGTACTCCGTAGATAGACAGCAAGGATGGATTG
GCCGAGACGTAGAAACAGACACGGAACTGTCTGTCTCGTTCAGACACTTGATCGCTGACCTGTGCCACCTTTTCTGGTCC
TTTTTCCTTCGCTTGCTCTCTTGCGGTGAAGCGATTCGATGATACGGAGTACCATGTATAAAAAGACAAGTCGGCCAGTG
GTGCTTGTACTGTCGGTCTGCACTGCAGCGTCCTCGACCCTCTGTTCATTCTCTCAACGGCCTCTATGCCACATGCATGA
GGCTTAAAATGGCCGCCAGAACCGCTGCTGTTGCCGCGCTGCGAACCAGAGCGAACCGTTGCCATTGACGCATGTCTCTT
GCCAACTCGGCCGTCGTCGAATCAGCAGCTGGGGAAACCACAGGCTGGGACCCACTTTCCCGCTCTCCTTTTCCATGCCT
GCCCATTTCAGCCCAGCCGTGCTTCTGCCCCGCTGGAGAAGCGACACTGTCCCCTCCTTTTTCTCACCAGCCGATATTTT
GATGTGTCCGCTCCTTTCTCCTTCCTCTCCCCCAAGACACGATCCTGCGCCCTTTTCGAATCCTCCTCCGGTCCATCCTC
TTCTCCCATCGGCTCCTCCGCTCAGACACAAACGCCGACATCTGTTTCCTGCTCTTCTCGTGGCCGAACTCCTTCTGTCC
GATTGCCAACTGTCCCCGCCTGCTGGCATCAATTTCACCGGCGATTGCGAGCGGTCTTTCTAATCAGTCGCTACGCCTCG
GCCGACGTGTCGACAGCAAGCTGTAGCTTCAAGAGACGCGCCTAAACCGCCTACACATTCCTGCTGTTCCTGCATCTCAC
CTTGTTGCCTCGCTGCTTTCAACGGCCTTTCCTGGTGATTCTCTCGGTCGCCTCGCCGCCCATCTTCTCATCCGCCTCGT
CTTAGACCTCGCTCGAATTTTACAAACAGCTCCGCCCTTTCCAAGATGGATTCTGAATACCCAACCACCACCGTGACGCC
GTCGCCGGTGGACCCCACCCCCGCTCCCCCTCCGGCTGAAGACCGTCGGAACATCCAGGTCGACAATGCTATTCGTGCCA
TAACGGACAAGCGGCCTGTGCCGGAGATGGACTTCACCATCCACGTTATGGAAGATGGCTCCAACGTCAGCACGCTCGAG
CGAGTGTGTAAAGGTCAGCCCGCCTCCCCTGCTCTCCGGCAGGCCAACCCTGTCCCAGCCTCGCGGCATCTGACCCTTTT
TCTTCCCTAGATGTCCAAGCACCGGCCACGTACAAGCCGACGGACGAGCAGTTCTTCACGGACGAGTCCCATACCAAGCC
CGACATCAATTTTCTGAAAACCCACTTCTACCGCGAGGGCCGCCTGACCGATGAGCAGGCCTTGTGGATCATCCACGCCG
GCACCGAGCTGCTGCGTGCCGAGCCCAACATGCTCGAGATGGACGCTCCCATCACTGTGTGTGGCGATGTCCACGGCCAG
TACTATGATCTCATGAAGCTGTTCGAGGTTGGCGGCGATCCGGCTGAGACCCGTTACCTCTTTCTTGGCGACTATGTCGA
TCGCGGATACTTTAGCATCGAATGCGTGCTGTACCTCTGGTCGCTCAAGATCCATTACCCAAACACCCTCTGGCTGCTCC
GCGGCAACCACGAGTGCCGTCACTTGACAGACTACTTCACTTTCAAGCTTGAGTGCAAGCACAAGTACTCCGAGGCCGTA
TATGACGCATGCATGGAATCTTTCTGCTGCCTGCCCCTGGCTGCCGTCATGAACAAGCAGTTCCTGTGCATCCATGGCGG
TCTCAGCCCGGAGCTGCACACGCTGGACGATCTGAAACGGGTAAGCCAACTCGGTCTCGGCTGTCCCACCATTGCACTCC
CGTGTTCGCCATCGTACTGATTTGTGTTTCTGCAGATTGACCGCTTCCGCGAGCCACCAACACAGGGCCTCATGTGCGAC
ATCCTCTGGGCCGACCCGCTCGAGGACTTTGGCCAGGAAAAGACAAGCGACTATTTCCTCCACAACCACGTGCGTGGCTG
TTCGTACTTCTTCTCGTACCAGGCTGCCTGTGCCTTTTTGGAAAAGAACAATTTGCTGTCCATCATCCGCGCACACGAGG
CGCAGGACGCCGGCTACCGCATGTACCGCAAGACCCGTACGACAGGTTTTCCCAGCGTCATGACGATATTCTCGGCGCCA
AACTACCTCGACGTGTACAACAACAAGGCGGCTGTGCTGAAGTACGAGAACAACGTGATGAACATCCGCCAGTTCAACTG
CACGCCACACCCGTACTGGCTGCCCAACTTCATGGACGTCTTCACCTGGTCGCTGCCGTTCGTCGGCGAGAAGATCACGG
ATATGCTGATTGCCATTCTGAGCACGTGTTCCGAGGAGGAGCTCAAGGAGGAGGCTGCCTCTCCGGGCCCGGTATCCCCG
CCCACCACACCTGGCTTCGGGAACATGGATCCGGACTCCATTGAATACAAGCGCCGGGCCATCAAAAACAAGATTTTGGC
CATTGGCCGTCTGTCACGTGTCTTTCAGGTGCTTCGAGAGGAGTCGGAGCGTGTCACAGAGCTTAAGACGGTCTCTGGCG
GTCGCCTGCCGGCAGGCACGCTTATGCTTGGTGCCGAGGGCATTAAGAATGCCATCAGCACATTTGAGGATGCCCGCAAA
ATTGATTTGCAGAACGAGCGGCTGCCGCCTAGCCATGACGAGGTCGTTCGCCAGAATGTAGAGGACCGGCAACAGGCTCT
TGAGAGGGCAACAAAGGAGGCTGACAACGACAAGAAGCTTCAGACACTGTCGCGGAGGCTCAGCACGTAAGTGTGCCTGT
TGACGTCGTTGTGTTCTGCGTTTTGCGTTTCGTCTCGAGATTGCTGATTGCTGACGTGGTGTTGCAGCAGTGAGCGCAAG
TAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62