GenePrediction:GLEAN_7282 Details

Name: GLEAN_7282
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2986279..2980537 (- strand)
Length: 5743
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2986279..2985598 (- strand)
Length: 682
Type: CDS
Source: GLEAN
Position: GCSC_140:2985532..2983146 (- strand)
Length: 2387
Type: CDS
Source: GLEAN
Position: GCSC_140:2982713..2982425 (- strand)
Length: 289
Type: CDS
Source: GLEAN
Position: GCSC_140:2982365..2980537 (- strand)
Length: 1829
>GLEAN_7282 class=GenePrediction position=GCSC_140:2986279..2980537 (- strand)
ATGTCGTCCGACAAAGGCAGACAGACGTCCAGCGGGAAGCCGTCGTTCTTCTCCCGAGTCAAGCACAAGTCCGACAAACG
AAATACCAGCGATGAGGGCAGGTTCCTCGGTCCGCTTGACATGGACGCATCCGGTTCTGTCGCAGCACGAACATCGCGGC
ACCACAACCGCGAGTCGTCGATCAACAACCGTGACTCGATCATCTCTGTTGACCGGCCCGGCTCACCCGAATCCGGCCTC
AATATGATGGCCGGGGTCATGACCTCAATCCCATACGACAGCGTTAGTCCGGATCATCGCTCTCCAGTGACGACCGAATA
CGCCAGCAGCATCGACGGGGGATATACTGGCCGTCGCGAACCACTGCCTCACCAACTCAATAAAGCCACGAGCGACTACC
ACCAATATCCGTCCTTTGACCCCGCCTCCTCTTCTGCAACCGCTGCTGCTGCCGTGGCCATGTCCATGTACAGCGCAGCA
CCCGGCGCTCACCTCTCTGCCGGGAGGCTTGCGCCGGGCACAAACAACCTCACCATGGCTTCGACTGGCCGCCAAACGCA
GCTTCAGCAATGGGGTCCGCCACGCGAGAGCAGCTACCAGACCACGTCGCACAATTCGCGATACAATTCGTATGCCCCAT
CCGTCGGCCGCACCTCGACAGACCAGGCCAGCATCATGTCCGGTATGTTTGCGCCCTAGCTCCCCCTTTCCCATGCCCGA
GTGCGGTGTGCTCACCTATTGTCGCAGCGTTGCCCAGCGCATCCTCACAAAGTTCCTACGCCTCGTATCGCGACTTAAAT
CGCACAGCCAAGACTTCCAACAGCGCAACAGTCACCACTGCCGACGGTGGCTTCGCTTTGGCGAAGCCGGACGACGACGT
GGTGATCGAGCAGATGTTTGTATCACTAATGCAAAAGCGTGGATGGCACAACCTGCCAGAGCAGGCGCGACGGCAGATGA
TCGCCTACCCTCCCACGAAGAAGTGGACGCTGATCTACCAGGACCGGTTGACAGAGTGGCAAGGCGAACAGCGACGTCGC
CAGTCGTCGCGGCCCGGCCAGTACCAGAACGTGGACATCACGACCTTTTCGGACGAAGAGGGCTCGCCGGAGTGGTATGT
GCGCAAGGTGATGGAGAACAGCCTGGACAGCAAGCACCTGGGCAGCCTGGAGGTCAACCTGCGGACGCAGCAGATCGGCT
GGGTAAAGCGATTTATCGAGTGCCAGGGCCAGGTGGCGCTCACGAACGTGCTGTTGAAGATTAACCGCAAGAGCGCGCGC
GGGCCGACGGTGCCGGACAGCGGCAAGGGCGACAAGGATGTGGAGCGGGAGTACGACATTGTCAAGTGCCTGAAGGCGCT
GATGAACAACAAGTATGGTGCGGACGACGCGCTCGCGCACCAGCAGGTGCTCGTGGCGCTGTGCATGTCGCTCATCTCGC
CGCGGCTGTCGACGCGGAAACTGGTCAGCGAAGTGCTCACGTTCTTGTCGCACTGGGGCAGCGGGGAGGGCCACATGAAG
GTGATCCAGGCGATGGACAGCGTCAAGAGCCAGCAGGGCGAGAACGGGCGGTTCGACGCATGGATGCGCATCATCGAGGT
CACCGTGGACGGGCGCGGCAAGATGGGCAGTCTGGTGGGCGCGAGCGAGGAGGTGCGCAGCGGGGGCATCGGGATGGAGA
ACCTGCTGATGGAATATGCGGTGGCAACGCTCATCCTGATCAACATGCTGGTGGATGCGCCGGAACGAGACCTGCAGCTG
CGGCTGCACATCCGGGCGCAGTTCACGGCGTGCGGCATCAAGCGGGTGCTGGCCAAGATGGAGGCATTCCAGTACGACCT
GATCGACAAGCAGATCGAGCGGTTCCGGTCGAATGAGGCGATCGACTACGAGGACATGCTGGAGCGGGACAACAGCAGCA
TAAAGGATAGCATCGAGGGCGAGGTCAAGGATCTGAACGACCCAGTGCAGATCGTGGACGCGATCCAGCAACGACTCAAA
GGATCGAAGACGCAGGACTACTTTGTGTCGGCGCTGCAGCACCTGCTGTTGATCCGCGACAACGACGGGGAGGAGCGGCT
GCGGCTGTTCCAGCTGGTGGACTCGATGGTCAGCTACGTGGCAATGGACCGGCGGCTGCCGGACATGGACCTAAAGCAGA
GCCTCAACTTCACGGTGCAGAACTTGCTCGACAAGCTGCACACGGACTCTGAGGCGCGGCAGGCGTTGGACGAGGCGCTG
GAGGGCCGGCAGATTGCCGAGGCGGCGATGGCGGAGCGCGACGAGATGAAGGCGCGGCTGGAGCTGGGGGCGGACGGGCT
GGTGGCCAAGATGCAGAAGCAGCTGGACGAGCAGACGCGATTCATCGAGGCGCAGCGGCGACAGGCAGACGCACTCAAGG
CGGAGATTGAGAGCGTGCAGACGCTGCGGGCGAAGGAGGCGCAGCGCAACGAGCTGGAGACACGCGAGCTGTACCTGATG
CTGCGCGACGCCCAGGATGTGGCGGCATCGACGGCAGCAGCGACGAAGGCGGCGGCAGGAGGGGCAGCTGGCGGTGGAGC
GGGCGGCAAGCTGGGCGACGTGGATCCGGTGCGCATGCAAGGCATCCTAGACCGCGAGAGACTTATGGAGCGTCTGCGGA
TGCAGATCGAGCGGCAGAAGACGCAGTACAAGCTGGAGGGACGGGTCTGGGGCGACGCGGTGGGACCGTCAGACCGGCTG
CGGGCGCTGCGCGAAGAGATGGAGGGCTACAGCGGCGCTGGCGATAGCGAGGGCCGGGGCGTGGAGGGCCTGCTGGGGGT
GGGCGAGGGCGGGCTGTCGCCGATGAGCGTGCTGGGAAGCGTCAGCCGGATCAGCCGACGACCGGTGGGCAGAGGCGGAC
AGCAGCAGCAGCAGCAGCACCAGAACGGAGGCTTGGGCGGATCAGGCGGCGACGAGAGCGAGGCGGGCGGCGAGGGTGGC
GAGGAGGGGGGTGTGAGCGAGGGCGGCGAGGGCGACGACGTGGTGTACGAGAAGCCACGGATGGTATCGATCCGGCGGCC
GGTGATCGATCCAAAGCAACAGAACGGGCTGATCAGCGAGATTGCCGGCAAGGTGCGGCGGTACGACGGCAGCGACTCGG
AAGACGGCGATGGAGTGACGACAGGACCATCACATCCCAGCCTCGAGTCTCAGTCACCGATCACGCCAAACGATCTCGAG
CCACCGAGGATTCAGATCACGGATGCATCATCCGAGACCACAGCAGGAGCACCACCTCCGCCTCCTCCGCCTCCTCCTAT
GCCCGGTCAGCTACCCGGTGCACCACCACCACCACCTCCTCCTCCTCCACCCTTTCCAGGCCAGCTGCCTGGTGCTCCGG
CTCCTGTATCACTTTCTGGTGCTCCTCCTCCGCCTCCACCGCCACCACCACCACCGATGCCTGGGATGCTTCCTGGCGCA
CCACCTCCACCTCCGCCACCTCCACCTCCACCTATGCCGGGCATGATGCCTGGCGCACCGCCGCCGCCACCGCCACCGCC
GATGGGCGTGCCCGGGTCGATGACTGGGCACTTCTTGTCTAAGCAGCCGACGTTTGGTTCGGTGACGTCGGTGGGCCTGC
CGGTGGTGAGGCCAAAGCGGAAGCTCAAGGCGCTGCACTGGGAGAAGGTGGATGAGACGGTGACAACACACTGGGCGGCG
CACACGCCATCGGCGGAGGAGCGCGAGGAGAAGTACCTGGAGCTCAGCCGCAAGGGCATCTTGGACGAGGTGGAGAAGCT
GTTTATGGCGAAGGAGACGAAGAAGATTGGCGGTGGCAGCGGGAAGAAGGACGACAAGAAGCAGATCATCTCGACGGATG
TGCGCAAGGCATATGGTGAGTGCATGTGGTGTTGTGTTGTGCTTCCGAGACGGTTCGGGTTGCTAACGGGCCAGAAATCG
CGTTTGCCAAGTTTTCGCAGCTGTCGGTGGACCGGGTGGTGCAGTTGATCATCCACTGCGACAAGGAGGTGCTGGACAAC
TCGGTAGTGATGGAGTTTTTGCAGAAAGACGACCTGTGCAACATTCCGGACAACGTGTCGAAGCTGCTGGCGCCGTACGG
CAAGGACTGGACAGGCCCGCGGACAGAGGAGGATACGCGCGAGGCAGACCCGGCAGAGCTGACGAGACAGGATCAGATAT
TTTTGCTGACGGCATACGAGCTGCACCACTACTGGAAGGGACGGATGCGGGCGCTGGCACTGACGCGCAGCTTCGAGGCA
GACTACGACGAGATCATGGGCAAGATCGGGCAGGTGGTGGCGGTGTCGGAGTCGATCCGCGACTCGGTGTCGCTGATGAA
CGTGCTGGGACTGATTCTGGACATTGGCAACTACATGAACGACGCGAACAAGCAGGCGCGCGGATTTAAGCTGAGTTCGC
TCGCGCGTCTGGGCATGGTCAAGGACGACAAGAACGAGTCGACGCTGGCGGACATGGTGGAGCGGATTGTGCGACAGCAG
TATCCGGAGTGGGAGGCGTTTGCGACGGACATTGGGGGAGTGCTGACGGCGCAGAAGATCAACATCGAGCAGCTGCAGGC
GGACGCGAAGAAGTACGTGATCAACATCAACAGCGTGCAGAGGTCGTTTGACAGCGGCAACCTGTCGGACCCGAAGCGGT
TCCACCCACAAGACCGCGTGGCGCAGGTGGTGCTGCCGGTGATGAAGGAGGCGCGACGCAAGGCCGAGCAGATGGAGCTG
TACCTTGAGGAGATGGTGCGAACGTACGACGACATTATGGCATTTTACGGCGAGGACTCACGTGACGAGAATGCGCGCCG
CGACTTTTTCGCCAAGCTGGCGCTGTTCATCCAGGAGTGGAAGAAATCGCATGAGAAGAACGTGCAGTACGAGGAGACGC
GGCGGCGCAACGAGGCGAGCATGAAGCGAAAGCACGCGGCGCAGCTGAAGGCGAACGGCGGTGTGGGCGGAGCCGGCGAC
CCGATGATACCGCTGCCGAGTCCGACGAGCGCCGGAGCCATGGACAGCCTGCTGGAGAAGCTGCGGGCGGCAGCGCCACA
GACACGTGACCAGCGAGATCGGAGACGGCGAGCGCGGCTTAAGGACCGGCACCAGGTGCGGATAGCGTCGGGTCAAAAGG
TGGCGGACCCGAACGAGAGCGGCGACGGCGAGGCGGGACGGCCGGGCAGTGCGTCTGGAGGAGGGAGTGGAGGAGCAGCA
GCCGGGATCGAGAGACGGAGCTCGCTGTCGACGACCGGAGGAGGAAGCGAGAGCCAAGCAGCCGGTCTTTTGGGGAGTGG
CAGCGGCAGCAGTGCGCTGACGCCGATACCGGCATCGCCTAGCGAGGGTGACGCCAACGACAACGGCGACGGCGGCGACG
TGGCAGCACGAGCGGCACTGATGCTGCAGGGGATGCGGGGCGACGAGGCCGACGAGGAGAAGCGGGAGAGCCAGCGGAAG
ATGCGGCGCCAGACGGCCGAAGAAGAGCGGCGGTCACGACGACGACGACGTGAGCGCGCCCAGTCTGGCACCATTGTCGG
CGGCGTGCCCAGTCTGGCCGAATCGGATGCCGGTGGCGGCAGCGATGTGGCGCCAACGACACCGACGACACCGGCAACAC
CGGCAGACGAGGGGGTGAGCGATACAGTGCGTGTGTCCGTGTCGACAATACCAAGCACTGTGAAGGAACTGCCCGAAGTG
CCAGAAGCGAGAGAGACCGAGACGGAAGAAGCGACAGCAGAGGCACAGGCGACGGAGGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62