GenePrediction:GLEAN_7283 Details

Name: GLEAN_7283
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2978922..2977808 (- strand)
Length: 1115
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2978922..2978497 (- strand)
Length: 426
Type: CDS
Source: GLEAN
Position: GCSC_140:2978431..2977808 (- strand)
Length: 624
>GLEAN_7283 class=GenePrediction position=GCSC_140:2978922..2977808 (- strand)
ATGTCGTGGAAGACGCTCGACGAGCTCCAGTGGAGCGACCCGGCGGCGGCCGACGAGATGCAGGGCATCCACTCCAACTC
GATCCTGTTCTACTTTATGCGGTCGCCGTACTTTGACAAGACGTCCAACAACAACACGGTGTACAACCAGGCGATGCACA
ACGCCAGCATGTTCCCGGTGCTGGAGACGCGCGAGCGGTTCGAGGACTTTCTGCGCGGCATGTCGGGCGTCGAGTACGTG
GTGCACCAGGCGCCGGCCGAGATGGCTCCGGGCACGGGAACGGGCGTCTGGGTGATCCGCAAGCAGCTGCGGCGGAAGCG
CAGCGACGGCCAGCCCGATGACCTGACCGTCTACGCAGACTACTTTGTCGTCGGCTTGAACGTGTACCAGGCGCCGACGC
TGGGGGACGTTTTGAGTTCGCGGATCGTGGGTGCCTCTCTTTATTTTGCTTTTCTTTTCCTTTGCTTTTCTTCATACCTC
TGACTTCCCAGACCTCCATTGCCGTCTCTCTCAGCAAGGCCTTTCCGGCCATGGACAGCATGCAATCCTGGTCGCCGGCA
CGTGGACACGTCTATGCGACCCGCGAGGACGAAGAAGACGATTACGACGACGACGACGACGACGACGACGACGATGATGA
CGACGACGATGACGATGACGAAAGCGAAGACGAAGACATGGTCGACATTGTCAACATAAACAGCAGCAAAAGTAGCCCAG
GCAGCAGCCACAGCCTTGGCCGCGAACAAGATGTCCCCCGGGCCGACAAGGAATCCGGGCTCGACCCGCGGCTCGCCGAG
GAGTCGTATGCCATCCACATGATGTTTGGCGGTGAGTACATGGATGAACAGCCTGTGTCTGGACGACCGGGCGAGTTCCA
TCTCTCGGCGGCCTCGCGCAAAAACGCCAGCGCGGCCAAGGCCCAGGAAAACACGGCCGACTCGGCCGACAGCAACTCTA
AGCAGCAGCAGCAGCAGCAGCAGGAACAGACAGCCAGCAAGAAGACGTCACCCGTTAGCAAAGACGGCAAGAGCGGAAAG
AGCGCGGCTGGTGGGCCAGGAAAGGCCAAACGGCGCAAGAGCAAGGGCGCGTCGGCAGCTCAGCCTGGTTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62