GenePrediction:GLEAN_7284 Details

Name: GLEAN_7284
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2973136..2972592 (- strand)
Length: 545
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2973136..2972984 (- strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_140:2972930..2972592 (- strand)
Length: 339
>GLEAN_7284 class=GenePrediction position=GCSC_140:2973136..2972592 (- strand)
ATGGAAGAGCCTGTTGTTCGCACCGCGCCCTACCCGGCACCGTCGAGCAAGGTGTTGGGAACGGTCAACGGCATCCCCAC
GGAGGTGGAAGTCATCTCGTTCACAGACAAGATCATGGTCCTGATCTCCCAGGGCGGCCGGTTGGCACAATGGGTACAAG
AGAGAGAACCTCTTCTGACAAGACTCACGCTGACGCGGTGGCACAGATCGAGGTGCCTCTCTCAGCACCCTCGGCAGCAT
CGGTGGATGCGGCCCTGCCGGCTGGGCTCCGGGGCAGCAGCGGACCCGACCTGCTGCCGTCGACGCACCTGACGCCCAAG
ACGCTCTTCGGGGCTGGCGGCCAGGCACGGGAAACGTTTGGACAGCTGGTGGCGGCACAGGTAGGCAGCCTGCTGGCACT
GCGGGACGCGACCGACAGCCGGACGGTGGTCGTCGGGCTGGGGCTGGAGCCTGATCAGGACGTCGGGCAGGGTGGCGGCG
GCGACAGCTCGCAGGCGCAGGCAATCTACTTTGACATTGTCGAGCTGGTGCAGAAGGTGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62