GenePrediction:GLEAN_7285 Details

Name: GLEAN_7285
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2971618..2970244 (- strand)
Length: 1375
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2971618..2971616 (- strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_140:2971563..2971516 (- strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_140:2971352..2971198 (- strand)
Length: 155
Type: CDS
Source: GLEAN
Position: GCSC_140:2971135..2970244 (- strand)
Length: 892
>GLEAN_7285 class=GenePrediction position=GCSC_140:2971618..2970244 (- strand)
ATGGTACGCCTCAGCTTCTTCTTCATCGTCTCCACGTCCTGCTAACAGCCAATAGGTCAAGGTTCTTCTCGTTCTGTACG
ATGGTGGTCAGCACGCCCGTGATGTAAGTCTATGTTGTCTGTGTTCGATGTGGTCGTCAGAACGCGGGGTATACGCTGCG
GCCGACGCTCGGCATGTTGGCGAGATCGGCATGAGGGCGGTAGCACGGCTCTGCAGCAGATTGATGACTAAGCAATACAT
GAGCTGACGAGTGTGATGTGATGCAGGTGCCGGAGCTTCTGGGCACGACGGAGAACGAGCTGGGGATCCGCAAGTGGCTC
GAGGATCAGGGCCACACGCTGGTGACGACCTCGGACAAGGAGGGCGAGAACTCTACGTTTGACAAGGAGCTGGTCGATGC
GGAGATTATCATCACGACGCCGTAAGTGTCCCATGCCCTTTTTGAGTTTTCAGTGTCCCACAGGACGAAACTGACCTCCT
CAGATTCCACCCTGGCTACCTGACGGCGGAGCGTCTGGCCAAGGCCAAGAAGCTGAAGCTGGCGGTGACGGCGGGCATCG
GATCGGACCACGTGGACCTGAACGCGGCCAACAAGACGAACGGCGGGATCACGGTGGCGGAGGTGACGGGGTCGAACGTG
GTGTCGGTGGCAGAGCACGTGGTGATGACGATCCTGGTGCTGGTGCGCAACTTTGTGCCGGCGCACGAGCTGATCGAGGC
GGGCGAGTGGGACGTGGCAGCCGCGGCCAAGAACGAGTACGACCTGGAGGGCAAGGTGGTGGGCACGGTAGCGGTCGGCC
GCATCGGCGAGCGCGTCCTCCGGCGTCTCAAGCCGTTCGACTGCAAGGAGCTGCTCTACTACGACTACCAGCCGCTGTCG
CCCGAGAAGGAGGCCGAGATCGGCTGCCGTCGCGTCGACACGCTCGAGGAGCTCGTCGCCCAGTGTGACATCGTCACCAT
CAACTGCCCGCTGCACGAGAAGACGCGCGGCCTGTTCAACAAGGAGCTCATCGCCAAGATGAAGCCCGGCTCCTGGCTCA
TCAACACGGCTCGCGGTGCCATCGTCGTCAAGGAGGACGTCGCCGCTGCCCTCAAGACTGGCCACCTCCGCGGCTACGGC
GGCGATGTCTGGTTCCCCCAGCCCGCTCCCAAGGACCACGTCCTCCGCTACGCCAAGAACCAGTGGGGCGGCGGCAACGC
CATGGTCCCCCACATGTCCGGCACCTCGCTCGACGCCCAGCAGCGCTATGCGGCCGGCACCAAGGCCATCCTCGACAGCT
ACCTCAGCGGCCGCTTCGATTACCGCCCCGAGGACCTCATCGTCACCGGTGGCGACTATGCCACCAAGGCGTATGGCCAG
CGCGAGAAGAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62