GenePrediction:GLEAN_728 Details

Name: GLEAN_728
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1686655..1689001 (+ strand)
Length: 2347
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1686655..1687227 (+ strand)
Length: 573
Type: CDS
Source: GLEAN
Position: GCSC_97:1687351..1687823 (+ strand)
Length: 473
Type: CDS
Source: GLEAN
Position: GCSC_97:1687882..1687959 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_97:1688014..1689001 (+ strand)
Length: 988
>GLEAN_728 class=GenePrediction position=GCSC_97:1686655..1689001 (+ strand)
ATGTGCGTCAGCCTTGGTGGCGACCTGCCGTCTGCGTCTTCCAATGAGGCCCTTGCCGAGCGACTAGGCCGGATCGAGGC
CCTTCTCGAGGAGCAGAACCAGCGGCTGCGCGAGTTTGCAGGGGCTCCAGGGACTGTTTCTGGCGGCCATGTCGCATTGC
CCTATGGCACTAGTGTGCCGTACCTGAACTCGACCGAGGCGGCGTCGTATGCACGTCAGGCCCAGGCCCAGGCCCAAGCC
CAAGAGCCGGTGCCGGCCCACGACCATGTGCAGTTCCTGATTCCGATCGACCACACGACGGCGCCCAACACGCTGCTGTC
GCTGGCAGTGGTGCAGCAGGCGCTCAGCAACATCGCCGACCGACGCGGCGATACGAGCCAGGCCCGACTGCGGGGACGAG
GCAGCCGAGGCAGTGGAAGCGGCAGCAGGAGCACCAGTGCACGTGGCCGAAGCACTGGACATCGTGCTCCAGTTCCAGTG
GCGACGCCCCTGGCTTCACCGCGCTTCGGCTTCCCGAGAACGTACTTTTATGAGATTGAAAGGGCTCAGCCACTGCCGAC
TGGCTTGGATGTCGTCCGACAGCAACAGCGGCAGCAGCAGCAACTACAACAGCAACAGCAACACCTTCTCTGGCTGCCAC
CCGTCGTTCTAAATGCCTTGAATGACGACCCGTCTCTGCTGGACTGGCTCTCGGAGAACTACTTTATGATGGTGCATCCG
GCGGCGCCGCTGTTCCGACGCAGCGAGTTTGGCGTCTGGGCCGCGCAGGCTGCCCAGGCCTTTGAACCAGACACAGGGGC
AGCCGGTGGCGGGTCCATCGAAAAGGCCATCTGCCTCTGCGTCTGGGCGCTGGGATGTCTGGCACCCAGGCAGGACAGCC
GGGTGGCGGCAGCAGCAGCGGCAGCGGCAGAGACTGCTGTCTCCGCTCCTTCAACACCGGTCTCCGGCACCCGACAGACG
GACCGGGACCGACTCGCGCAGGCACTCTTCCAGCCGGCTCTCGGCATCATCATGCACCACGCCGTGTGGACGCTGGGGCC
GCCAACGTCGCTCAAGACATGTCAGGCCCTCCTGCTGGCAGCAGCATACTTTTCACACATGGGACGTCCGCTGCACAACG
CGCGGCTGACTTATCTGGCCAGCCGGTTCTTCCTGCACATCTTCAACGGGTGAGTCGCGGGAGTGGCGTATCACCTTTCC
AGGCACATTGCTGACAGTTGGACACAGACGGCAGCGCGACGGGTCAGCACCAGAATCGGACGAGAAGCTGATTCGGGTGT
TCTGGGTGTGTTTCATGCTGGAGAGGTAAGCAAGCCAGACATAGACAGACGACGGGATAGTCTCGGGCTGACAGGATAGT
GACCGGATGGCGGAATTTGTGCTGCTGCGCAGCGGAGTGGAGCCGCTGGCGGACGAGTTGCCGCTGCCCAACTACACGGA
CACGGGCGAGAGCGACGTGATGATCACGTTTGTGGCGGAGACGTCGGTGCGTCGGCTGCTGAACCGGATCCACAGCCTGC
TGTACTTTGCAGTCGAGGAGGAAGGCGAGACGGGCGGACAGGACGACGGCAGCAGCAGTGCGGCTGCCAGCGGACGAGCA
GGATGGAGCGGGCAGCACGAGCCGAGTCCGATGGGCGGGCTTGACGACATCAGCCAGCTCAACAAGATCCTGCCCATCAG
CACGGAGCTGAACCGACAACTGGAGGCGTGGCACAACAGCATTCCGGAGCATCTGCGGCCGCCGCTGCAGGCGAAGTTGT
TGGAGGACGACGACAGCGACGATGAGGCGGACAAACCGGACGGTGGAGATGACGAGGAGGATGCCGAGGGCGAAGACGAT
CCGGAACACCGCGACGGCTGCTGTCCGGCAACGATGGCGGCCGAGATGGCGCTGCATGAGCGGGTGAGCGTCCTGCGAGC
ACGCTACTACGAGGCGCGGCATCTCATCCACCGGCCGTTTGTGCTGGGCGTTGCAGGCCACCAACAACAACAACAACAAC
AACAACAACAACAAATCCCGCTGGCCGTGCTGGACAAGTGTGTCGTGTGCGTGGACTCGTGCGTGGCGTATCTGCGCCAT
GTGCTGCCGCTGTTGGGCCGTCGGTCGCCGTATCTCTGGTCGCAGTGCCAGAGCTGTCTGGCCTGTCTGGTGGTGCTGGC
CGTGGCTGACACGTGTCCGGATATTGTGGCGCGGGTGGCGGCAACGGAAGGGACGGCGACGAGGACGACGACCCGGCGGG
ACGACATGGGCAGGCTGCGCAGCAGAGTGGCTGGGCGGCTGCGGCAGTGGGCGACGACGGGATCGAGCCTCGAGGCAGAG
CTCCGGATAGTGGAGAGTCTACCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62