GenePrediction:GLEAN_7299 Details

Name: GLEAN_7299
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2900605..2898278 (- strand)
Length: 2328
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2900605..2900406 (- strand)
Length: 200
Type: CDS
Source: GLEAN
Position: GCSC_140:2900340..2900232 (- strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_140:2900066..2898834 (- strand)
Length: 1233
Type: CDS
Source: GLEAN
Position: GCSC_140:2898763..2898278 (- strand)
Length: 486
>GLEAN_7299 class=GenePrediction position=GCSC_140:2900605..2898278 (- strand)
ATGGCCGGCCTACAGTTCGCCACGTTCAACTCTCTCATTGAGATGCCCTTCTACACGGCGCTTTTTGCCTCGAAGCTCGA
CCATGACAAGCTGGACGACTCGGCTCGCTCTGTGCTCGGCCTCTACGAGCCCCGGGGCGAGAAGGATCCGGGTCTGAGCT
CCCAGATGCAGATTCTCGGTGGAGCGCTGACCAGCAACCAGTACGCCAGCTTGACGTGGTCTAACTGATTTGTGGCCTCC
TGTCGGCTAACACTGCCTCTCCCAGGACGCCCGCTGGCATGATTCGCGCAGAGGGCATCATCAAGAACTTCAACACGGTT
GAGGACTTCAAGCAAGCTGACAAGGCAGCCATGCTTCATACTGCGGCTAGACAGGTGTGTACAGAATGTTTTGTGCCTTT
CACGAAACAGCAAGGATCGTCGTCGTTTGCTGACCACGTCCGGTCACCAGATCTGGGATGCTAAATCAAAGATGGCAGTA
TATACGAAGTTCCCTCCCTCCTCTCCTCGTTCAACATCATATCTTTTGCCGACCTGAAGAAATACCGGTTCACGTACTGG
TTTGCGTTTCCCGCACTGCATTCAGATCCACAGTGGAAAAGGGTTGGCGATATCGAGCATTTAGGACGGGAGGAAACCAC
CCTTCTCGTCGACAAGGTTGGTACGTGGCGCTATGCAACAGACAACCGGCAGCACGGCTTCTTTCTTGCCAAGCGTGTGC
GGATCGACAGCGCAGGCGGCGACAAAGAGGAGGCAAGAAATGCTTACCTCCACGCCGATGAAATTGCTTTGGGCTTCCAG
TGGGTAGTAGGCTCGCTACGCGATTTCGAGTCGGGCTTCTTTAATGGCGTGGACGAGGAGGATCAACTGATCTCGTTTGT
CGACCCGTCTACCTATCCAGAGAATCCGTCGTGGCCGTTGCGCAATCTCCTGGTGCTGGTGCGTCAGCGCTATCACCTGC
GCAAGGCGCGGATTCTCTGCTACCGCGACACGCAAGGGCGGCGAGACGACCCGCGCAGTGTGATTCTTCCTGTGGCGATG
GATGAGGCATCCAGCAGGGAGACGACTGATCTGCCAAAGGTCACTGGCTGGGAGCGCAATGTCAATGGAAAGCTGCAGGC
ACGCATGGTCAATCTGGCAGATTACATGGACCCAACACGGCTCGCAGACCAGGCTGTGGATCTGAACCTGAAGTTGATGA
AGTGGCGCATCTCACCGAACCTTGATCTGGACAGCATCAAGGACGTATCGTGTCTATTGCTCGGGGCAGGGACGCTGGGA
AGCTACGTTTCCCGGAACCTGATGGGCTGGGGTGTCCGGCGCATAACGTTTGTCGACTACGGATCCGTGTCGTTTTCAAA
CCCTGTACGCCAGCCGCTCTTTGAGTTCAAGGACTGTCTCCACGGCGGTGCACCCAAGGCGACGCGTGCGGCGGAGTCGC
TGAAGCAGATTTATCCGGGGGTCGAGTCGGCCGGTTATGTCCTTTCTGTTCCAATGCTCGGTCACCCGGTGTTGGACGAG
GAGAAGACGCGGGCTGACTTTGAGAAGCTGGAGGAGCTGATTGACAAGCATGATGTTATTTTCCTGCTTATGGACACGCG
CGAGTCACGATGGCTCCCGACCATAATAGCCAAGGCGAAGGGAAAGATCGTTATGAATGCAGCTCTTGGTTTCGACACAT
ATGTTGTCATGCGCCACGGTCCGGCACCTGCCAAAGGCTTCGAGGATACGCTTGGCTGCTACTTCTGCAATGACGTTGTC
GCCCCAGCAGATGTGAGTCTCCCTCTGATAGCCTTTGTCCTGGCAATTTGAGCTTACTGCTGACTCTTGTCCTACATCCA
AGTCTGTCAAAGACCAGACCTTGGATCAGCAGTGCACGGTCACGCGGCCCGGCGTGGCTGCTATTGCATCGGCACTGCTC
GTGGAGCTGTTGACAAGCGTATTGCAGCACCCATTACGGCACTATGCACCGGCACCCAAGCCCTTAAGCCGGCCAGGGAA
CTCGGTGGCGACGTACGAGCGAGACCCGGAGAGCCATCCTCTAGGTCTGGTGCCACATCAGATTCGAGGCTTCCTGGCCA
ACTTTCAGAACATGCTCATCCAGGGCCCGGCGTACCCGCATTGCAGTGCGTGCAGTGCGCAGATTCTGAATGCCTACCGG
CAAGAAGGCTGGGATTTTGTGAAAAAGGCGCTGGGCGACCGCGAGTATGTGACGGAGCTGTCTGGTCTGGCCGAGATTCA
GCGGCAGGCCGAGGCGGTGGCGGAGCAGCTCGACTTCAGCGACGATGGAGACGATGACGGCGATGACGGCGAGGCCGTGA
TGCTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62