GenePrediction:GLEAN_729 Details

Name: GLEAN_729
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1701195..1703331 (+ strand)
Length: 2137
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1701195..1703252 (+ strand)
Length: 2058
Type: CDS
Source: GLEAN
Position: GCSC_97:1703317..1703331 (+ strand)
Length: 15
>GLEAN_729 class=GenePrediction position=GCSC_97:1701195..1703331 (+ strand)
ATGGCAGAACTGGACACGCTGGACATGTTCGTCCTCGCTGCCATTCTCCTCGGTACTCTGGCTTTTTTCACTAAGGGCAA
ACTATGGGCTAAACCTAAAGACCCGTATGGCAGTAGTGGCAATGCCATTGGCGTCAAGGCTGGCAAGACGAGGGATATAG
TGGCCGCAATGGAGGAGTCAGGCAAGAACTGTGTCATCTTTTACGGCTCCCAGACTGGAACGGCCGAGGACTATGCCTCG
CGCCTCTCGAAGGAGGGCAAGAGCCGATTTGGCCTTGAGACCATGGTGGCCGACCTGGAAGACTACGACTACGAAACCCT
GGATGCTATCCCGTCCGATCATGTCGTCATGTTCGTCATGGCCACCTACGGCGAGGGCGAGCCGACTGACAACGCGGTGG
AGTTTATTGAATTCATCGCTGCCGACGAGCCAGCCTTTTCCCAATCGTCCGAACCGGCCCTAGCCAACCTCAACTACGTC
GCTTTCGGTCTCGGCAACAACACGTACGAGCACTTCAACTTCATGGTCCGCAAGGTTGACAAGACTCTTCAGAAGCTCGG
TGCCCACCGCATCGGCGCTGCTGGTGAGGGTGATGACGGCGCCGGCACAATGGAGGAGGACTTCTTGGCTTGGAAGGAGC
CCATGTGGGCTGCCCTCGCCGAGAAGCTGGGTCTGGAGGAGCGCGAGGCCGTCTACGAACCCATCTTCGGCATTTCCACG
GTCGACAGCCTGACTCTCGAGGACGCCTCGGTCTACCTCGGCGAGCCGAACAAGATGCACCTCGAGGGCACTGCCAAGGG
CCCTTTCAACGTCCACAACCCCTATATTGCCCCCATCGTTGAGTCCAAAGAGCTGTTCGGTGGCAAGGACCGCAACTGTC
TGCACATCGAGATCGACATCAGCGGCTCCAATTTGTCCTACCAAACTGGTGATCACATTGCTATCTGGCCCTCCAACCCC
GGTGTTGAGGTCGACCGCTTCCTCAATGTCCTCGGCTACGGCGACAAGCACAACGATATCATCAGCGTCCAGGCTCTGGA
GCCCACGGCCAAGGTTCCCTTTCCTACGCCTACCACGTATGATGCTATTGTCCGCTATCACATGGAGATCTGCGCCCCGG
TGTCTCGCCAATTTGTAGCCACGCTTGCCGCTTTTGCCCCCGACGAGGCCTCCAAGGCCGAGATGACCAAGCTCGGTAGT
GACAAGGACTACTTCCAGGAGAAGGTCAGCTCCCACCACCTCAACATTGCCAGCTTGCTCGAGCGTGTCGGCAAGGGCCA
GAAGTGGACCAACGCCCCTTTCACGGCCTTTATCGAGGACATCAACAAGCTTCAGCCCCGTTTCTACTCCATCTCGTCTT
CCTCGCTGGTGCAGCCCAAGAAGATTTCCATCACAGCCGTTGTCGAGTCGCAAGTGATTCCTGGCCGCGACGATGCCTTC
CGCGGCGTCACGACCAACTACCTCCTCGCCCTGAAGCAGAAGCAGAACAACGACTCGAACCCTGCCGCATTTGGCCTGAC
CTACGAGATTGCCGGTCCCCGCAACAAGTACGATGGTATCCGCGTCCCTGTGCACGTCCGCCACTCCAACTTCAAGCTGC
CATCCGACCCGTCCAAGGACATCATCCTCATTGGCCCCGGCACTGGTGTGGCTCCCTTCCGTGCCTTTGTTCAAGAACGC
GCCCAGCAAGCTGCTTCCGGTGAGATTGTTGGCCGCACGCTGCTCTTCTTTGGCTGCCGGAAGTCGACCGACGACTTTGT
CTACCAGGACGAGTGGAAAGAGTACAAGAAGGCCCTAGGCGACGGCTTCGAGGTCATCACGGCCTTTTCGCGGGAAGGCT
CTAAGAAGGTATACGTCCAGCACCGTCTCAAGGAGCGCAGTGAGGAGGTCAACAAGCTGCTAGAGAACAAGGCTTATATC
TACGTGTGCGGTGATGCGGCCAGTATGGCCCGCGAGGTGAACGTTGTGCTGGGCCAGATCATGGTCAGCCAGCGTGGCAT
TTCTGATGCTAAGGCTGAGGAGATCATCAAGAACATGCGCGCATCTAACCAATACCAGGTAAGCAAGCATATGTCCAGGC
CGCACTACTATCTTTGTCCACGACTAACCACTCCATGTGCAGGAGGACGTTTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62