GenePrediction:GLEAN_7300 Details

Name: GLEAN_7300
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2897774..2895682 (- strand)
Length: 2093
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2897774..2897432 (- strand)
Length: 343
Type: CDS
Source: GLEAN
Position: GCSC_140:2897372..2897273 (- strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_140:2897218..2897206 (- strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_140:2897136..2895682 (- strand)
Length: 1455
>GLEAN_7300 class=GenePrediction position=GCSC_140:2897774..2895682 (- strand)
ATGTTGCGCCCGACCTGGTTGTCCTTCGCTCGCCGGGAAGTGTCTATTGAGGACTACCCGGGCACTCTGGTACCGTTGGA
AGAGGCCCATCTGTACAGCCACTCAGCTCGCACCGGACGGACCGAGTATGAAACCTTGGCCGAGGATGATGTGGACGAGG
ACGAGGAGGCACTGGATCAGCGTGGCAAAGACACGATAGACGGCGACGGCGACGTCGAAGCAGAGTCTGTCGGGATGTTG
TTGATGCGGGCGTGTGAGTATAGCATCGAGGGGCTGCGGCGTGAAGTCCGGAGTAGCCCGAAAGACAGCCCAGGCAGCCA
GACGACATGGACCGACTACGAACGTGAGCAATGCCCGGCAGCCAGCTCCCAGCAGAAAGATAATAGAGACTAAGGTGAAC
AGTGAAATCCAAGCTCATCAACAAGGCAATCCAAGATATCGGCATGGGTCGATACAACTGGGAGCTGTTCTGTCTCTGCG
GCTTCGGCTGGTTTGCCGACAAGTGAGTGTCTCCCTCTTTGGTTTGCATGGACAGCTGCTGACTGCATCTTGACAGCCTA
TGGATGCAAGTATGTTGTGTGGCAATCCCCTTGCTTCCGCTGCCGTGCTTGCCGTTCTAATCAGGTCACACATCTCAGGG
CATCTCCCTCATATTGCCATCGTTGTCGGCCGAGTTTGGCATTGGCGAAAAGACGGTCCGCTACACGACCAGCGCGTTAT
TTCTCGGACTCTGCTTTGGCAGCTTCTTCTGGGGCATCGGGTCGGACGTTCTGGGGCGTCGGCTTGCGTTCAACTGCACG
CTCCTCATCACCAGCATATTCGGGACTGCTGCAGCATATGCGCCCAGCTGGGGATCCGTCTGTGCTCTTGTCGCCGCCCT
CGGCTTTGGTGTGGGTGGAAACCTGCCCGTCGACGGAGCTCTGTTCCTCGAGTTTCTACCTGACGCATCCAGCTCGCTGC
TGACGTTGCTGTCAGTCTGGTGGCCGATGGGCCAACTCTGCTCATCGCTGCTGGCCTGGATGCAGATTGCCGATGTTAGC
AGCGGCACGTCCAGTGGCTGGCGCCGATTTGTGACCACGATCGGCCTCTTGACGTTTGCCATGTTCTTGATCCGCTTTTT
CGTCTTCCGTCTGTTCGAGTCGCCCAAGTTTCTGCTCTCGCAGGACCGTCAGGCCGAAGCAGTCGCGGTGATTCACGGGC
TTGCTCACCGCAACGGCACCAAGACGTGGCTGACGGGCGACATTCTCGATGCGGTCGCACACGGCGGAAACAACGGGACG
AGTATAGGGAGCGGCTGGAGAGATGGACCCGGATACCAAGCGGCTGGATACGAGGCTGCTCCTGGTGTGCCGCTGAACAG
ACAAGCAACAGCATCATCGGCAACTGGTCGGCCGGCAACGACGATGCTGGACCTGGTCCACAGCCGGCTCAAGTCTTTCT
CGGGCGAGCGTCTGCGGCCACTGTTTCAGTCGCGACAGCTGGGCATGGCGACAGTCATCATCTGGATCGTGTGGGCCACC
ATCGGCATGGGATATCCGCTGTTCAACGCGTTCCTGCCGCAATACCTGTCCCATGGCGACTCGTCGGCAGAGGCACCGTC
GGATGCGGCCGCACAAACATTGACTTCCAGCACGACGTACCGCAACTACGCCATCACCAGCATTGTCGGCGTTCCCGGCA
GCCTGTTAGCCGCTTACACGGTCGACAGCCCGTCGCGATTTCTGGGCCGCCGTGGCACGCTGGCCATCTCGACGCTGGTG
TCAGCGGTTTTTCTGTTTGTCTTTGTCACGTTTGGCCACTCGTCGCGGTCGCAGCTGGTCTTCTCCTGCATCGAGGCCTT
TTCGCAGAACATCATGTACGGCGTCCTGTACGCCTTCACGCCCGAGATATTCCCAGCACCTGTGCGTGGTGCCGGAACGG
GCGTGGCCAGCTTTCTGAACCGCATCACAGGCCTGGTGGCGCCTGTGCTGGCAGCAACATTGCCGGGCGACGGGTCTACG
GCGCCCATTTACCTCTCGGCAGCCCTGATCCTGTTGGCGTTTGTCGGCATGGTGCTGATTCCGATTGAGACGCGTGGCCG
ACAGCGGTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62