GenePrediction:GLEAN_7301 Details

Name: GLEAN_7301
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2893909..2892016 (- strand)
Length: 1894
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2893909..2893889 (- strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_140:2893814..2892862 (- strand)
Length: 953
Type: CDS
Source: GLEAN
Position: GCSC_140:2892664..2892016 (- strand)
Length: 649
>GLEAN_7301 class=GenePrediction position=GCSC_140:2893909..2892016 (- strand)
ATGCCTCCGGCCAATCTTGTGGTGAGCCGTTTTGTGCGCGCGTGTGCGATGGCGCGGTGGCCCGACGTGCCGAGCTGACC
GCAGGCCGGATGCAGACGAGGATCAAGGTGCAGCTGAAGCTGTCGATTGCGCGGCTGCGGATGGTGCAGCACCGCGACGA
GGCGCTGTCCAAGGCATCGCGGCGGGCGATGGCGCAGCTGCTGGAGGCGGGCAAGGAGGACTCCGCGCGCATCCGGGTCG
AGAACATCATCCGGTCGGACATCAGCACGGAGCTGCACGAGATGCTAGAGCTGTACTGTGAGCTGCTGCTGGCTCGTGCC
GGTCTGCTCGAGAGTCCGGTCTGCGACCCGGGCCTGGAAGAGGCTGTCAAGAGTCTCATGTACGCGGCGCCCAAGACCGA
GATCAAGGAGCTGCACCAGGTCCGCGTCCTGCTGGCCGAGCGCTACGGCAAGGACTTTCTCGTCGCCGCCATGGACAACG
TCGGCGGCAAGGTCTCGCCCAAGGTCGTCCGCAAGCTCAGCGTCGTCCCGCCGCGCGACGAGCTCGTCCAGGGCTACCTC
GAGGAGATCGCCAAGGCCTACGGCGTCCGCTGGCCGCGATCCCGAGCCGACGACGACGACGATGCCCTGCTCGAGCCGCC
GCCCGAAGCCCTGGCTCTCGATCTGGTCGATCTGGACAATATCGACAAAGACGACGACGACAAGACCGACGGCGACCATC
CCCTTGCTGCCTCTTCCGTCGCCCCGGCCACGCCCTCTCGGCCACGCCCCTCGGCCAAGGAGGCCAGGGAACAGCTAGAC
CTCACGCGCGCCACGCCTCCGAAAACAGCCGTCGGAAGCCTCCCGGCAGTCCTGCCGCTGCACGTCAATCCGCCCAGCCC
GTCTACCGACAACATCCATCCTCGCGTCACGCTCGATTCCCAGGAGCTCAAGCCGGGTACCTCGTCCCCGAGGATCACAG
CCGCCGATCCGGCTGCCCGACGGCTCGTCGTCAAGAAAAAAGACACTGTGGATGACGAGCTGGCCCGCCGCTTTGCCAGC
CTGAAGCGGTAGTTAGCAGCCGGACCTCCTGTACATACTACGATCTTATGACGTGCTTTTGTGGCGTTTGTATTGCTGCC
TTTCGTTTGCTATTTCGAGTCCTTCACTCGCCTTGTAAATACGCGGGATGGCCTACCACAAGTCAATTTGCGTCTCTTCT
CGTGTTGTGTCTGTCCAAGATTAGTCAACTACGACATGTGCACAGCTTCGCTGTTTTCGGCCCTTTTCGCGAGCGCGTCG
TGTCGCGACTTCAACTACAAACCCTCGTCCACGTCCGTCAGCCCAAAGGAGCAGGTCCGCGAGCCGAATCCGAGCATTTG
ACCATGGAAGAAGGTTATAACGGCACAGCGATAATCCTGTCCCGGGTGACAAATGGCAGGCCGGAGAGCATACGACTAAC
TCGGCATCGGACAGGAGACTTGGCATACTACCGCTTTCAGGACGACAGACGCGTGGCCAGAAGCTCCATTGTGCGCCAGT
ACTTTGACTTTGCTCTGGACTGGTCCGCCAAGAAACCGCAGCGCGACCGGGATGACCATGACCGAGAGACTTTTTCAAAG
GCTGAGAACAACGAAGCGGAAGCTCGGGACAGTCTATCTGTCCTCTGCATATCTGCGGATGAAGAAAGGACAGCAGCTCC
TCGAAAGAAGAAGTCGCGCCGGCGGCTCCGAAAAAAGGTCGCCAAGGCCCTCGGCAATCTGCAGAATATGTCCGCCAGCC
AGCTGTTCTACGAAGACGTCCATCGAGACGGCTTCATGAGCCAAGAGGAAGGCGAGACACGCAGTCTTCCTGCTTGGCAA
ACGAACGGCTCCGACGACGATGATTTCCACTACCAGCCGCAGAACAACGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62